ID: 1147486443

View in Genome Browser
Species Human (GRCh38)
Location 17:40819191-40819213
Sequence CTCTAACGTTGGAAAACGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147486430_1147486443 27 Left 1147486430 17:40819141-40819163 CCGCGTCCGCCGCCTCCGGAACT 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1147486443 17:40819191-40819213 CTCTAACGTTGGAAAACGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1147486438_1147486443 12 Left 1147486438 17:40819156-40819178 CCGGAACTAAACGGGGTGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1147486443 17:40819191-40819213 CTCTAACGTTGGAAAACGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1147486429_1147486443 30 Left 1147486429 17:40819138-40819160 CCGCCGCGTCCGCCGCCTCCGGA 0: 1
1: 1
2: 1
3: 52
4: 577
Right 1147486443 17:40819191-40819213 CTCTAACGTTGGAAAACGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1147486436_1147486443 15 Left 1147486436 17:40819153-40819175 CCTCCGGAACTAAACGGGGTGAG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1147486443 17:40819191-40819213 CTCTAACGTTGGAAAACGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1147486435_1147486443 18 Left 1147486435 17:40819150-40819172 CCGCCTCCGGAACTAAACGGGGT 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1147486443 17:40819191-40819213 CTCTAACGTTGGAAAACGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1147486431_1147486443 21 Left 1147486431 17:40819147-40819169 CCGCCGCCTCCGGAACTAAACGG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1147486443 17:40819191-40819213 CTCTAACGTTGGAAAACGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147486443 Original CRISPR CTCTAACGTTGGAAAACGGT GGG Exonic
901900813 1:12360493-12360515 CTCAATCTTTGGAAAAAGGTGGG - Intronic
906624060 1:47310511-47310533 CTCTAACGTATGAAAATGATTGG - Intronic
923696377 1:236256121-236256143 CTCTCTCCTTGGAAAAAGGTTGG + Intronic
1064316110 10:14258617-14258639 CAGTAACATTGGAAAACAGTTGG + Intronic
1070533295 10:77356441-77356463 CTCTACAGTTGGAAAAGTGTGGG + Intronic
1091967143 12:4754445-4754467 CTCTAACTTTGGAAAGAGGAGGG - Intronic
1107320143 13:39177734-39177756 CTCTAACGTGGGAATATGCTTGG - Intergenic
1115102513 14:29720023-29720045 CTTTAACTTTGGAAAATGTTGGG - Intronic
1119383309 14:74241731-74241753 CTCCAGCTTTGGAGAACGGTGGG - Intronic
1138947297 16:61867021-61867043 CTCTCACATTGGAAAAGGGAGGG - Intronic
1145736826 17:27238923-27238945 CTCGAAGGTTGGAGAAGGGTTGG + Intergenic
1145876880 17:28325641-28325663 CTCAAAGGTTGGTAAATGGTGGG + Exonic
1147486443 17:40819191-40819213 CTCTAACGTTGGAAAACGGTGGG + Exonic
1148883020 17:50746214-50746236 CTCTAACTTTGTAAAAAGGTTGG - Intronic
1160623734 18:80188854-80188876 CACGAACGTGGGGAAACGGTAGG - Intronic
1168586552 19:57598670-57598692 CTTTAATGTTGGAAAACAGAAGG - Intergenic
928910000 2:36410107-36410129 CTGTAAAGTTGGAAAAGGGAAGG + Intronic
931008671 2:57882070-57882092 CTCTAAAGTTGGCAATAGGTGGG + Intergenic
942029308 2:171943003-171943025 CTCTAATGTTTGAAAATGTTTGG - Intronic
948366878 2:237461492-237461514 CTCAAAAGTTGTAAAACAGTAGG + Intergenic
1169211662 20:3769074-3769096 GTCTAAAGTTGGCAGACGGTGGG + Intergenic
1170844074 20:19947386-19947408 CTCTAATGGTGGAAAAGTGTAGG - Intronic
958127370 3:89374441-89374463 CTCCAACATTGGAAAAGGGAAGG + Intronic
982667286 4:158280874-158280896 TTCTAATGTTTGAAAACTGTTGG + Intergenic
982749951 4:159149024-159149046 CTCTAAGGCTGGAAGAGGGTAGG + Intronic
984596625 4:181676343-181676365 CTGTAACTTTGGAAAATGCTAGG + Intergenic
988060345 5:26159485-26159507 CAGTAACTTTGGAAAACAGTTGG - Intergenic
993382438 5:87223047-87223069 CTCTAACATTGGAAAACAACTGG + Intergenic
993756074 5:91732161-91732183 CTCAATGGTTGGAAAACTGTAGG - Intergenic
994874499 5:105400175-105400197 CTAAAAGGTTGGAAAATGGTAGG + Intergenic
1006933728 6:37703123-37703145 CACTAATGTTGGAAAAGGGGAGG + Intergenic
1008017915 6:46541916-46541938 CTCTACCTTTGGAAAAGGGAGGG + Intergenic
1012766510 6:103373549-103373571 TTATAACTTTGGAAAACTGTGGG + Intergenic
1013912285 6:115290814-115290836 CACTAAAGTTGGAAAATGTTAGG + Intergenic
1018532113 6:164776589-164776611 CTCTAAAGTTGGATAACAATTGG - Intergenic
1019913876 7:4118496-4118518 CAGAAACGTTGGAAAACAGTTGG + Intronic
1027416445 7:77979556-77979578 CTCAAAGGTGGGAAAACTGTGGG - Intergenic
1031325888 7:120396587-120396609 TACTAACGTTGGAAAACAGAGGG + Intronic
1037512941 8:19602395-19602417 CGCACACGCTGGAAAACGGTGGG + Exonic
1042732003 8:71946459-71946481 CTCTAGCTATGGAAAACTGTGGG - Intronic
1052209927 9:25892081-25892103 CTCTACAGTTGGACAAAGGTTGG - Intergenic
1057445510 9:95111706-95111728 CTTTAACGTTTGCCAACGGTTGG + Intronic
1198885063 X:141326782-141326804 CTCTAACATTGGACAATGGTGGG + Intergenic