ID: 1147488899

View in Genome Browser
Species Human (GRCh38)
Location 17:40845361-40845383
Sequence CTCTTGAAACTTCTGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147488899_1147488903 9 Left 1147488899 17:40845361-40845383 CCAGGGGACAGAAGTTTCAAGAG No data
Right 1147488903 17:40845393-40845415 AGAGGAGAATTTTGAGAAGATGG No data
1147488899_1147488904 10 Left 1147488899 17:40845361-40845383 CCAGGGGACAGAAGTTTCAAGAG No data
Right 1147488904 17:40845394-40845416 GAGGAGAATTTTGAGAAGATGGG No data
1147488899_1147488901 -9 Left 1147488899 17:40845361-40845383 CCAGGGGACAGAAGTTTCAAGAG No data
Right 1147488901 17:40845375-40845397 TTTCAAGAGAGCCAGTGGAGAGG No data
1147488899_1147488905 14 Left 1147488899 17:40845361-40845383 CCAGGGGACAGAAGTTTCAAGAG No data
Right 1147488905 17:40845398-40845420 AGAATTTTGAGAAGATGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147488899 Original CRISPR CTCTTGAAACTTCTGTCCCC TGG (reversed) Intergenic
No off target data available for this crispr