ID: 1147488904

View in Genome Browser
Species Human (GRCh38)
Location 17:40845394-40845416
Sequence GAGGAGAATTTTGAGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147488899_1147488904 10 Left 1147488899 17:40845361-40845383 CCAGGGGACAGAAGTTTCAAGAG No data
Right 1147488904 17:40845394-40845416 GAGGAGAATTTTGAGAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147488904 Original CRISPR GAGGAGAATTTTGAGAAGAT GGG Intergenic
No off target data available for this crispr