ID: 1147490704

View in Genome Browser
Species Human (GRCh38)
Location 17:40863449-40863471
Sequence CAAACAGACGTAGCATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147490704_1147490707 4 Left 1147490704 17:40863449-40863471 CCAAAGGATGCTACGTCTGTTTG 0: 1
1: 0
2: 1
3: 9
4: 46
Right 1147490707 17:40863476-40863498 CGAGCCTACCATGGCGAGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 46
1147490704_1147490705 -5 Left 1147490704 17:40863449-40863471 CCAAAGGATGCTACGTCTGTTTG 0: 1
1: 0
2: 1
3: 9
4: 46
Right 1147490705 17:40863467-40863489 GTTTGCGCACGAGCCTACCATGG 0: 1
1: 0
2: 0
3: 0
4: 14
1147490704_1147490710 24 Left 1147490704 17:40863449-40863471 CCAAAGGATGCTACGTCTGTTTG 0: 1
1: 0
2: 1
3: 9
4: 46
Right 1147490710 17:40863496-40863518 GGGACTGTAGCTCGATCTCCAGG 0: 1
1: 0
2: 14
3: 7
4: 96
1147490704_1147490706 3 Left 1147490704 17:40863449-40863471 CCAAAGGATGCTACGTCTGTTTG 0: 1
1: 0
2: 1
3: 9
4: 46
Right 1147490706 17:40863475-40863497 ACGAGCCTACCATGGCGAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147490704 Original CRISPR CAAACAGACGTAGCATCCTT TGG (reversed) Intronic
900350266 1:2231080-2231102 CAGACAGACGTAGCAGGCTGGGG + Intronic
914048732 1:144114205-144114227 CAAATGGACGTGGCATCCTTGGG - Intergenic
914130452 1:144851243-144851265 CAAATGGACGTGGCATCCTTGGG + Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
919469342 1:197959023-197959045 CAAACAGAAGTTGCAGCCTTGGG - Intergenic
920821524 1:209386203-209386225 CCCAGAGACGTAGCATTCTTGGG - Intergenic
1064143779 10:12811331-12811353 CTAACAGAAGTAACAACCTTGGG - Intronic
1075462802 10:122629917-122629939 CAAACACACTTAGCATTGTTGGG - Exonic
1080209046 11:29764100-29764122 CAAACACTTGGAGCATCCTTTGG - Intergenic
1081516107 11:43831816-43831838 CTAACAGAAGTAGGGTCCTTGGG - Intronic
1083855858 11:65392772-65392794 CAAACAGATGTGGCACCATTGGG + Intronic
1091580856 12:1788124-1788146 CCAACAGAAGTAGCAGCCTCTGG + Exonic
1093082030 12:14823315-14823337 TAAACAGCAGTAACATCCTTGGG + Exonic
1096884684 12:54705112-54705134 CAAACAGATTTAGCGTCTTTTGG - Intergenic
1097969076 12:65612895-65612917 CAAACAGAGGGAGCAACCCTTGG + Intergenic
1107766198 13:43737482-43737504 CAAACAGAAGCAGCATTCTGTGG - Intronic
1108888403 13:55220969-55220991 CAAACAGAAGTAGTATATTTGGG - Intergenic
1110403910 13:75127265-75127287 CAAACACACTTAGCCTCCTGTGG - Intergenic
1113007749 13:105726371-105726393 CCAACAGTCATAGTATCCTTTGG + Intergenic
1123447142 15:20339538-20339560 CAAATGGACGTGGCATCCTTGGG + Intergenic
1129113463 15:73351860-73351882 CAGACAGACTCAGCAGCCTTCGG + Intronic
1147490704 17:40863449-40863471 CAAACAGACGTAGCATCCTTTGG - Intronic
1156213205 18:34969732-34969754 CAAACAGAGGAAGCATTCATTGG + Intergenic
1158190114 18:54818144-54818166 CAAATAGCCGTACAATCCTTTGG + Intronic
1166041543 19:40205827-40205849 CAACCAGACGCAGCAGCCCTGGG + Intronic
928678606 2:33675801-33675823 AAAAAAAATGTAGCATCCTTTGG + Intergenic
933958119 2:87388293-87388315 CAAATGGACGTGGCATCCGTGGG + Intergenic
933958171 2:87388486-87388508 CAAATGGACGTGGCATCCTTGGG + Intergenic
934242242 2:90280211-90280233 CAAATGGACGTGGCATCCGTGGG + Intergenic
934242293 2:90280403-90280425 CAAATGGATGTGGCATCCTTGGG + Intergenic
934270880 2:91536284-91536306 CAAATGGACGTGGCATCCTTGGG - Intergenic
934270930 2:91536477-91536499 CAAATGGACGTGGCATCCGTGGG - Intergenic
936176128 2:110221542-110221564 CAAACAGAAGTGATATCCTTTGG - Intergenic
1174846139 20:53944944-53944966 CAAACAGACCCAGTATCCATCGG - Exonic
1180553221 22:16557530-16557552 CAAATGAACGTGGCATCCTTGGG + Intergenic
1181350780 22:22256536-22256558 CAAATGGACGTGGCATCCTTGGG - Intergenic
1183244301 22:36681942-36681964 CATGCAGACTTGGCATCCTTTGG - Intronic
1184202310 22:42979180-42979202 CAAACAGATGAACCATCATTGGG - Intronic
953641066 3:44708856-44708878 CAAACACACGTAGCAGTGTTAGG - Intergenic
959285664 3:104405754-104405776 CAAACAACCCTAGCATCCCTAGG - Intergenic
974289995 4:59917259-59917281 CATACAGAATTATCATCCTTGGG + Intergenic
988395252 5:30689159-30689181 CAAACAGACATAGTATCCTTTGG + Intergenic
996409491 5:123142755-123142777 CAAACTGAAATAGAATCCTTTGG - Intronic
998903484 5:146879071-146879093 CAAAGAGAAGTAGGTTCCTTTGG + Intronic
1003055758 6:2818737-2818759 CAAAGAGACAGAGCAACCTTCGG + Intergenic
1025955744 7:66181605-66181627 CAAACAAACAAAGCATACTTAGG - Intergenic
1035024514 7:155817164-155817186 CAAGCAGACGGAGCATCCGGAGG - Intergenic
1040712049 8:50200405-50200427 GAAACAGACGTTGATTCCTTGGG + Intronic
1052967261 9:34349601-34349623 CAAACAGAGGAAGCGTCTTTCGG - Intergenic
1061300434 9:129701601-129701623 CAACCATACGCAGCATCCCTGGG + Intronic
1185533425 X:839630-839652 CAAATGGACGTGGCATCCTTGGG + Intergenic
1185533462 X:839800-839822 CAAATGGACGTGGCATCCTCAGG + Intergenic
1185533577 X:840310-840332 CAAATGGACGTGGCATCCTTGGG + Intergenic
1185533614 X:840480-840502 CAAATGGACGTGGCATCCTCAGG + Intergenic
1186668422 X:11743494-11743516 TAAACATACCTAACATCCTTTGG - Intergenic
1196461342 X:115935241-115935263 CAAACAGACATAGGAGCCCTTGG - Intergenic
1196556985 X:117099987-117100009 CAAACACACGTCTAATCCTTGGG - Intergenic