ID: 1147491366

View in Genome Browser
Species Human (GRCh38)
Location 17:40870449-40870471
Sequence GAAGAACCTCAGCTTCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147491366_1147491376 27 Left 1147491366 17:40870449-40870471 CCTCCCCGAAGCTGAGGTTCTTC No data
Right 1147491376 17:40870499-40870521 AGCAGTGCCCACTGGGGATTAGG No data
1147491366_1147491374 20 Left 1147491366 17:40870449-40870471 CCTCCCCGAAGCTGAGGTTCTTC No data
Right 1147491374 17:40870492-40870514 CAGAACTAGCAGTGCCCACTGGG No data
1147491366_1147491375 21 Left 1147491366 17:40870449-40870471 CCTCCCCGAAGCTGAGGTTCTTC No data
Right 1147491375 17:40870493-40870515 AGAACTAGCAGTGCCCACTGGGG No data
1147491366_1147491378 29 Left 1147491366 17:40870449-40870471 CCTCCCCGAAGCTGAGGTTCTTC No data
Right 1147491378 17:40870501-40870523 CAGTGCCCACTGGGGATTAGGGG No data
1147491366_1147491377 28 Left 1147491366 17:40870449-40870471 CCTCCCCGAAGCTGAGGTTCTTC No data
Right 1147491377 17:40870500-40870522 GCAGTGCCCACTGGGGATTAGGG No data
1147491366_1147491373 19 Left 1147491366 17:40870449-40870471 CCTCCCCGAAGCTGAGGTTCTTC No data
Right 1147491373 17:40870491-40870513 CCAGAACTAGCAGTGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147491366 Original CRISPR GAAGAACCTCAGCTTCGGGG AGG (reversed) Intergenic