ID: 1147491425

View in Genome Browser
Species Human (GRCh38)
Location 17:40870885-40870907
Sequence GAAATTAAACAAATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147491425_1147491427 -3 Left 1147491425 17:40870885-40870907 CCATGATCCATTTGTTTAATTTC No data
Right 1147491427 17:40870905-40870927 TTCTTGAGAGAATGAAAATCTGG No data
1147491425_1147491428 4 Left 1147491425 17:40870885-40870907 CCATGATCCATTTGTTTAATTTC No data
Right 1147491428 17:40870912-40870934 GAGAATGAAAATCTGGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147491425 Original CRISPR GAAATTAAACAAATGGATCA TGG (reversed) Intergenic
No off target data available for this crispr