ID: 1147495404

View in Genome Browser
Species Human (GRCh38)
Location 17:40910901-40910923
Sequence GGGAAGAAAAAGTTTAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147495404_1147495409 1 Left 1147495404 17:40910901-40910923 CCCATCTTAAACTTTTTCTTCCC No data
Right 1147495409 17:40910925-40910947 TCTCCATTTTTGAGAGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147495404 Original CRISPR GGGAAGAAAAAGTTTAAGAT GGG (reversed) Intergenic
No off target data available for this crispr