ID: 1147498140

View in Genome Browser
Species Human (GRCh38)
Location 17:40937150-40937172
Sequence GAGCTGGCTTTCCCTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147498140_1147498146 21 Left 1147498140 17:40937150-40937172 CCTGGAGAAGGGAAAGCCAGCTC 0: 1
1: 0
2: 2
3: 22
4: 254
Right 1147498146 17:40937194-40937216 GAATAAAGCTTGCTGTGCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 162
1147498140_1147498143 -7 Left 1147498140 17:40937150-40937172 CCTGGAGAAGGGAAAGCCAGCTC 0: 1
1: 0
2: 2
3: 22
4: 254
Right 1147498143 17:40937166-40937188 CCAGCTCAGAACAGGATCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147498140 Original CRISPR GAGCTGGCTTTCCCTTCTCC AGG (reversed) Intronic
900323627 1:2096789-2096811 GAGCTGGCTGACCCTTCCCTTGG - Intronic
900604236 1:3516718-3516740 GAGGGGGCTTTGCCTTCTCAGGG - Intronic
900896131 1:5484159-5484181 GACCTTTTTTTCCCTTCTCCTGG - Intergenic
900927194 1:5713123-5713145 GTGCTGGCTGTACCTTCCCCAGG + Intergenic
901777378 1:11569665-11569687 GAGCGGGCTGTACTTTCTCCTGG + Intergenic
903223362 1:21881129-21881151 GAGCTGGCCTCCCCTCCTCCCGG - Intronic
903657135 1:24956460-24956482 GAGGTGGCTTTCTCTCCCCCTGG + Intronic
903914737 1:26755512-26755534 GAGGTGGCTTCCCCTTCTTCAGG - Intronic
904197357 1:28795761-28795783 GAGGTGGCATGCACTTCTCCTGG - Intergenic
904318796 1:29683153-29683175 GAGCTGGCTTTCCCTCTTCCTGG - Intergenic
906380416 1:45328885-45328907 TAGCTGCCTTGCCTTTCTCCTGG + Intergenic
907302413 1:53496596-53496618 AAGATTGCTCTCCCTTCTCCTGG - Intergenic
908113796 1:60922164-60922186 TCACTGGCTTTCCCTTCTGCAGG - Intronic
908170486 1:61499852-61499874 TACTTGGCCTTCCCTTCTCCAGG + Intergenic
909103191 1:71376939-71376961 AAGCTGGTTTTCCTTTCTGCTGG + Intergenic
909407956 1:75313550-75313572 GAGCTGGCCTTGACTGCTCCTGG + Intronic
912467363 1:109883285-109883307 GAGCTGGCTCTCCATGCTCTTGG + Intergenic
912928896 1:113938448-113938470 CATCTTGCTTCCCCTTCTCCCGG - Intronic
918839208 1:189513068-189513090 ATGATGGCTTCCCCTTCTCCTGG - Intergenic
918946747 1:191076191-191076213 GAGCTGGGTCACTCTTCTCCTGG - Intergenic
919905701 1:202076894-202076916 GCGCTGGCTCTCTCCTCTCCAGG - Intergenic
920126171 1:203695385-203695407 GCTCTGGCTTTCCCTCCTACTGG + Intronic
920501411 1:206487757-206487779 GAGGTGGCTGTCCCGTCTCTAGG - Intronic
920648978 1:207822847-207822869 GAGCTGGCCTTCCATTGGCCAGG - Intergenic
920759012 1:208763639-208763661 GAGGTGGCATTACCTGCTCCCGG - Intergenic
921277653 1:213535691-213535713 GAGCTGGCTTTCTCCTGGCCTGG + Intergenic
922584768 1:226725349-226725371 GAGCTGGATTTCCCTTCGGGTGG - Intronic
923104182 1:230841786-230841808 GCCCCTGCTTTCCCTTCTCCTGG - Intronic
923615504 1:235533890-235533912 GAGTTGGCTTTGCTGTCTCCGGG - Intergenic
924440824 1:244083626-244083648 GAGATGACTTTCCCAACTCCTGG - Intergenic
1064560257 10:16588748-16588770 TAGCTGGCTGACCCTTTTCCTGG + Intergenic
1066178721 10:32938961-32938983 CTGCTGGCCTTCCCTTCTACCGG + Intronic
1066656376 10:37702310-37702332 GAGCGGGCCTTCCCTCCACCGGG - Intergenic
1067067539 10:43112305-43112327 GGGGTGGCTCTCCCTGCTCCAGG + Intronic
1068532792 10:58208629-58208651 GTGCTGGCTTTCCCTAATGCTGG + Intronic
1069603478 10:69724754-69724776 AAGCTGGGCTTCCCCTCTCCTGG - Intergenic
1069714536 10:70512255-70512277 CAGCTGGCTGTCCCTGCTTCTGG + Intronic
1070526524 10:77300188-77300210 GAGGTGGCTTTCCCTTAATCAGG - Intronic
1070586074 10:77767265-77767287 GATCTAGTTCTCCCTTCTCCAGG - Intergenic
1071121920 10:82288091-82288113 GATCTGCCTTTCAATTCTCCTGG - Intronic
1071503759 10:86220993-86221015 GTGATGGCTTTGCCTCCTCCTGG - Intronic
1072811842 10:98468092-98468114 CAGCTGCCCTGCCCTTCTCCAGG + Intronic
1073416626 10:103389096-103389118 GAGTTGGCATTAGCTTCTCCAGG + Exonic
1075743417 10:124709894-124709916 GAACTGTCATTCCCTTCTCCAGG - Intronic
1075904024 10:126065035-126065057 GAGCTGCCTCTCCCTTTCCCCGG - Intronic
1076547409 10:131254526-131254548 GAGCTGGAGTTCACTTCTCAAGG - Intronic
1077035977 11:494708-494730 GGGATGGCTTGTCCTTCTCCAGG + Exonic
1078859135 11:15231098-15231120 GAGAGGGCTATACCTTCTCCTGG + Intronic
1079182946 11:18209502-18209524 TAACTGGATTTCCGTTCTCCAGG - Exonic
1081349168 11:42027309-42027331 CAGCTGGCTTTAACTTCTACTGG + Intergenic
1083691168 11:64409763-64409785 GAGCTTCCTCTCCCTCCTCCCGG + Intergenic
1084199313 11:67544792-67544814 GAGCTGGCTTTCCACTGTGCTGG - Intergenic
1084205119 11:67586606-67586628 GAGTTTGCCTTCCTTTCTCCAGG + Exonic
1084285380 11:68127889-68127911 GGGCTGGCCCTCCCTTCTGCAGG + Intergenic
1084972169 11:72777890-72777912 CAGCTGGCTTTCCCAGCTCTGGG + Intronic
1085132008 11:74048208-74048230 GAGCTTGATTTCTCCTCTCCTGG - Exonic
1086021529 11:82236650-82236672 GCAATGGCTTTCACTTCTCCTGG - Intergenic
1086504786 11:87494011-87494033 AAGCTTGCTTTTACTTCTCCTGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088818092 11:113434985-113435007 GACCAGGCCTCCCCTTCTCCAGG + Intronic
1089102678 11:115976720-115976742 GATGTGGCTTTATCTTCTCCAGG + Intergenic
1089149476 11:116353841-116353863 GTGCTGGCTTCTCCCTCTCCAGG + Intergenic
1089256697 11:117198016-117198038 GAGTGGGCTTTCCCCTCGCCAGG + Intergenic
1089505558 11:118959640-118959662 TAGCTTACTGTCCCTTCTCCAGG + Intergenic
1089515048 11:119026943-119026965 GGGCTGACTGTCCTTTCTCCTGG + Exonic
1090280513 11:125452124-125452146 GAGCTGTTTTTTCTTTCTCCTGG - Intronic
1091900646 12:4141355-4141377 GAGCCCGGTTTTCCTTCTCCAGG - Intergenic
1093932309 12:24966642-24966664 GAGCTGCCTCTCCATGCTCCAGG + Intergenic
1093954543 12:25201316-25201338 AGTCTGGCTTTACCTTCTCCAGG - Intronic
1094360427 12:29624591-29624613 GCACTGGCTTTCCCTGCTCTTGG + Intronic
1095985439 12:47996120-47996142 AAGCTGGCCTTGCTTTCTCCTGG + Intronic
1096526450 12:52212924-52212946 GGGCTTGCTTTCCCCTCTCCTGG - Intergenic
1096679040 12:53242571-53242593 CAGCTGGCTTTCCCCAGTCCTGG + Intergenic
1101718146 12:107329043-107329065 TAGCTGGCTTTATCGTCTCCAGG + Intronic
1102004891 12:109582841-109582863 GAGCTGGCTGGCCCTTCCCAGGG - Intronic
1102907483 12:116687996-116688018 GGGCAGGATTTCCCTTCTGCAGG + Intergenic
1104833581 12:131771999-131772021 GAACTGGCTTTCCCTTAGCCTGG + Intronic
1105833075 13:24182893-24182915 GAGCTGCCTTTGCCTTCTTTGGG - Intronic
1106162250 13:27212130-27212152 GAGCTGGCTCCCTCTGCTCCTGG + Intergenic
1106290542 13:28357281-28357303 GAACTGGGTTTCCTTTCTTCTGG + Intronic
1106461769 13:29976783-29976805 GAGCCGCATGTCCCTTCTCCAGG + Intergenic
1107985960 13:45776377-45776399 GGGCTGGATTTCTCTTCCCCTGG + Intergenic
1111479469 13:88804894-88804916 AAGATGGCATTCACTTCTCCAGG - Intergenic
1114259619 14:21026842-21026864 CAGCAGGCTTTTCCTTGTCCAGG - Intronic
1114406841 14:22464737-22464759 GAGCTGGCATTCCCTTTATCAGG - Intergenic
1115752606 14:36506553-36506575 AAGCTTGCCTTCCCTTCTTCCGG - Intronic
1115780400 14:36762356-36762378 GAGCTGCCTTTCCCCTCTGCCGG - Intronic
1119421103 14:74508551-74508573 GTGCTGGCTTCCCATGCTCCTGG + Intronic
1121274959 14:92661246-92661268 AAACTGGCCTGCCCTTCTCCAGG - Intronic
1122365479 14:101192594-101192616 GAAATGGCCTTTCCTTCTCCAGG - Intergenic
1125507380 15:40274564-40274586 GTCCTGGCTTTCCCTGCTCATGG - Intronic
1126787827 15:52192659-52192681 GAACTGGCTATTCCTTGTCCCGG - Exonic
1127620373 15:60727915-60727937 GACCTGGCTTCACCTCCTCCTGG + Intronic
1127732465 15:61813484-61813506 GCTCAGGCTGTCCCTTCTCCTGG - Intergenic
1128552411 15:68606934-68606956 CAGCTGGCTTGCCCCTTTCCTGG - Intronic
1128706736 15:69842343-69842365 GACCTGGCTTTCCCTGCCACCGG - Intergenic
1128747200 15:70123037-70123059 AAGCTGGCTCTCCTTCCTCCAGG + Intergenic
1128780181 15:70354044-70354066 GAACTGGCTTTCCAAGCTCCAGG - Intergenic
1129108762 15:73325451-73325473 GAGCTGACGCCCCCTTCTCCCGG - Intronic
1129752477 15:78076067-78076089 GAGCTGGGTATCCTTTTTCCAGG - Intronic
1129869336 15:78930750-78930772 GAGCTGGCTCTTCCTCCTGCAGG - Intronic
1130323417 15:82858874-82858896 CAGCTGGCCTTCCTTTCACCAGG + Intronic
1130989665 15:88868778-88868800 AAGCTGCCTTTCTCTTCTCCTGG + Intronic
1132661022 16:1061592-1061614 CAGCTGCCTCTCCCTTCTCTGGG + Intergenic
1132726798 16:1342419-1342441 GGCCTGGGCTTCCCTTCTCCGGG - Intronic
1133051297 16:3118899-3118921 GGGCAGGCTTTCCCTTCAGCAGG + Exonic
1134157505 16:11855560-11855582 CAGCTGGCTTCCCTCTCTCCAGG - Intergenic
1135349299 16:21715275-21715297 GGGGTGGCTCTGCCTTCTCCTGG + Intronic
1140473301 16:75226651-75226673 AAGCTGGCTTCCACTTCTGCGGG + Intergenic
1141657468 16:85423782-85423804 GCACTTGCTCTCCCTTCTCCTGG + Intergenic
1142087919 16:88194185-88194207 GAGCAGGCTGTGCCATCTCCAGG - Intergenic
1142140606 16:88471108-88471130 GAGCTGGGCTTTCCTCCTCCCGG - Intronic
1143490847 17:7284463-7284485 GGCCTGACCTTCCCTTCTCCAGG + Exonic
1143574081 17:7779584-7779606 AAGATTGCTTCCCCTTCTCCCGG - Intronic
1146456552 17:33013890-33013912 GAGCTTGCTGTTCCTTGTCCTGG + Exonic
1147420921 17:40321836-40321858 GATATGCCTTTCCCTTCTGCCGG + Intronic
1147498140 17:40937150-40937172 GAGCTGGCTTTCCCTTCTCCAGG - Intronic
1148541435 17:48483715-48483737 GAGCTGGAACTCTCTTCTCCAGG + Intergenic
1150300020 17:64040075-64040097 GTCCTGGCTTTGGCTTCTCCTGG - Exonic
1151434013 17:74083003-74083025 GAGTTGGCTCTCTCTCCTCCAGG + Intergenic
1152274889 17:79350374-79350396 CAGATGGGTCTCCCTTCTCCTGG + Intronic
1152378060 17:79928824-79928846 GGGCTGCCTTTTCTTTCTCCAGG - Intergenic
1152489322 17:80618937-80618959 AAACTGGCTTTTCCTTCTCTTGG + Intronic
1153225747 18:2898361-2898383 CAGCTGGCTTTAGCTTCCCCTGG + Intronic
1155936554 18:31760813-31760835 TAACTGGATTTCCGTTCTCCAGG + Exonic
1156325462 18:36070681-36070703 AATCTGGCTGTCCCTGCTCCAGG + Intergenic
1156529095 18:37797711-37797733 CAGGTGGCTTTCCCCTCACCTGG - Intergenic
1157419196 18:47531294-47531316 GCCCTGGCTTTGCCTTCTCTGGG - Intergenic
1157513296 18:48294076-48294098 CAGCTTGCTTGCCCTTCCCCAGG - Intronic
1157818897 18:50751140-50751162 GACCTGGATCTCCCGTCTCCTGG - Intergenic
1159891939 18:73961318-73961340 GAACTGGCTGTCCCCTCTGCTGG - Intergenic
1160045345 18:75381482-75381504 GACATGGCTTTCCTCTCTCCAGG + Intergenic
1161725217 19:5924614-5924636 GAACTGGCATTCGCTTTTCCCGG - Intronic
1161867839 19:6847791-6847813 GAGCGGGCTTCCACTTCTACAGG - Intronic
1164868223 19:31622851-31622873 GTGATGGCCTTCCCTTCACCAGG - Intergenic
1165145308 19:33726650-33726672 TGGGTGGCTTTCCCTGCTCCTGG - Intronic
1167693751 19:51002304-51002326 GACCTGGTTTCCCCTTCCCCTGG + Intronic
1168052839 19:53842539-53842561 GAACTGGCTTTACCCTCTGCTGG - Intergenic
1168430855 19:56278838-56278860 CAGCTGGGATGCCCTTCTCCTGG - Intronic
927864921 2:26582207-26582229 GAGCTGGCGTCTCCTGCTCCTGG - Intronic
928138947 2:28710941-28710963 AAGGTGGCCTTCCCTTCTCAAGG + Intergenic
930357544 2:50341047-50341069 GTGCAGGCTTTCCCTTCTATTGG + Intronic
930836727 2:55802212-55802234 CAGTTTGCTTTCCCTTCTCCTGG + Intergenic
931899226 2:66769486-66769508 AAGGTGGCTTTGCTTTCTCCGGG + Intergenic
933775827 2:85770673-85770695 GAGCTGGCTTTCCCTGAACGTGG + Intronic
938079005 2:128359343-128359365 GGGCTTGCCTTTCCTTCTCCTGG + Intergenic
938082847 2:128379413-128379435 GCGCTGGCTCTCCCTTCCCTGGG + Intergenic
938692587 2:133806029-133806051 GAGCTTGTTTTCCCCTTTCCTGG + Intergenic
938971733 2:136439056-136439078 GAGCTGGTTTTCAGTTCTCATGG - Intergenic
939174560 2:138734599-138734621 TAGCTGGCATTCCCATCTTCAGG - Intronic
940650848 2:156438982-156439004 GAAGTGGCATTCCCTTCACCAGG - Intronic
942046123 2:172100460-172100482 GAGCCGGGGTTCCCTCCTCCCGG - Exonic
945977476 2:216282162-216282184 GAGGTGCCTTTCCCTGCTGCTGG - Intronic
946207907 2:218124118-218124140 GTGCTGGCTTTCCCAGATCCTGG + Intergenic
948759667 2:240182863-240182885 GACCTGGCCCTTCCTTCTCCTGG - Intergenic
1170416012 20:16143200-16143222 GAGTTGGCTTTGCATTCTCTTGG - Intergenic
1172055178 20:32149849-32149871 GAGCTTGGTTCCCTTTCTCCAGG - Intronic
1172753510 20:37267822-37267844 GGGCTGGGTTTTCATTCTCCGGG - Intergenic
1173566234 20:44040394-44040416 CAGCTCCCTTTCCTTTCTCCAGG - Intronic
1173834873 20:46118555-46118577 GGGCTGCCTCTCTCTTCTCCCGG + Intronic
1174287495 20:49483352-49483374 GAGCGGGCTTTTCCTCCTCGCGG - Intergenic
1174771563 20:53305352-53305374 GAGCTGACTGTGCCTTCTACCGG - Intronic
1175166492 20:57048020-57048042 GCACTGGCTGTTCCTTCTCCCGG - Intergenic
1175309174 20:57999483-57999505 GAGGTGGCTTTCCCTCCACAGGG - Intergenic
1175720168 20:61280969-61280991 CTGCTGGCTTTCCATTTTCCAGG + Intronic
1175861629 20:62153382-62153404 GCGCTGTCTTGCCCTTCTCAAGG + Intronic
1178900176 21:36592289-36592311 GAGCTTGCTCCCCCCTCTCCTGG + Intergenic
1179832351 21:44005190-44005212 GGACTGGCTTTCCCTGCACCCGG + Intergenic
1180087758 21:45515719-45515741 CAGCTGGCTGTCCATCCTCCTGG - Exonic
1180942663 22:19669675-19669697 GAGCTGGGTTTCACTTCCCCAGG - Intergenic
1183348404 22:37320339-37320361 CAGCTGTCCTTTCCTTCTCCAGG - Intergenic
1183375808 22:37464377-37464399 GGCCTGGCTTTCCTTTCTCCGGG + Intergenic
1183877066 22:40791892-40791914 GAGCCTGCTTTCCATTCTTCTGG - Intronic
1184901279 22:47448076-47448098 GTGCTGGGAGTCCCTTCTCCTGG + Intergenic
1185060443 22:48603682-48603704 CAGCTGCCTCTCCCTTCTCCTGG + Intronic
950570847 3:13799058-13799080 GAGCTAGCTTTGTCTTTTCCTGG - Intergenic
954581272 3:51704127-51704149 GACCTGACTTCCCCTGCTCCAGG + Exonic
954713312 3:52515451-52515473 GATCTGGCTTCTCCTTCTCCCGG + Exonic
954934640 3:54315219-54315241 GGGCTTGCTTTGCCCTCTCCAGG + Intronic
962402943 3:135077257-135077279 GACCTGCCATTCCCTTCTGCAGG + Intronic
964985199 3:162729816-162729838 GACCTAGCTATCCATTCTCCTGG - Intergenic
966656425 3:182363766-182363788 GAGCTTTCTTTCCTATCTCCTGG + Intergenic
968525301 4:1053894-1053916 GAGCTGACTGTCCCCTCTGCTGG - Intergenic
968525307 4:1053917-1053939 GAGCTGACTGTCCCCTCTGCCGG - Intergenic
968525327 4:1054000-1054022 GAGCTGACTATCCCCTCTGCTGG - Intergenic
968525366 4:1054169-1054191 GAGCTGACTATCCCCTCTGCTGG - Intergenic
968525407 4:1054355-1054377 GAGCTGACTGTCCCCTCTGCTGG - Intergenic
968525413 4:1054378-1054400 GAGCTGACTGTCCCCTCTGCCGG - Intergenic
968525432 4:1054461-1054483 GAGCTGACTGTCCCCTCTGCTGG - Intergenic
968525484 4:1054687-1054709 GAGCTGACTGTCCCCTCTGCTGG - Intergenic
968525490 4:1054710-1054732 GAGCTGACTGTCCCCTCTGCCGG - Intergenic
968525509 4:1054793-1054815 GAGCTGACTGTCCCCTCTGCTGG - Intergenic
968525559 4:1054999-1055021 GAGCTGACTGTCCCCTCTGCTGG - Intergenic
968525579 4:1055085-1055107 GAGCTGACTGTCCCCTCTGCCGG - Intergenic
968525597 4:1055168-1055190 GAGCTGACTGTCCCCTCTGCTGG - Intergenic
968525644 4:1055354-1055376 GAGCTGACTGTCCCCTCTGCTGG - Intergenic
968525660 4:1055420-1055442 GAGCTGACTGTCCCCTCTGCCGG - Intergenic
968913321 4:3486516-3486538 GACCTGGGCCTCCCTTCTCCTGG + Intronic
968919263 4:3514337-3514359 GCGCTGGCTTCAGCTTCTCCTGG + Intronic
968956216 4:3721164-3721186 GAGCTTACTTTCTCTTCCCCGGG - Intergenic
968990273 4:3906342-3906364 GAACTGCCCTTCCCCTCTCCTGG + Intergenic
971372579 4:26030120-26030142 GACCTGGCTTTCCCATCTCTGGG - Intergenic
978287398 4:107095073-107095095 AAGCTGGCCCTGCCTTCTCCTGG + Intronic
981246733 4:142549568-142549590 AAGATGTCTTTACCTTCTCCAGG + Intronic
985082444 4:186279925-186279947 GAGCTGACTTTACTTTCTCTAGG + Intronic
986215405 5:5714824-5714846 GGGCTGGTCTTCCCTTCTCCAGG + Intergenic
986627651 5:9737622-9737644 GAGCTGCCTTTCCTTTTCCCTGG + Intergenic
992772495 5:80061275-80061297 GCCCTGGCTTTGCCTTCTCGAGG + Intronic
993010533 5:82477524-82477546 GAGCTGGGCTTCTCATCTCCTGG + Intergenic
993137372 5:83986708-83986730 CTGCTGGCTGTCCCTTCTACAGG - Intronic
995376943 5:111484392-111484414 GAGCTTCCTTGCCCTTCTCTGGG - Exonic
998098627 5:139413284-139413306 GAGCTGGCAATGCCTCCTCCTGG + Exonic
998522271 5:142812025-142812047 GAGTTGGCATTCTCATCTCCTGG + Intronic
998866935 5:146515014-146515036 GAGCTGGGTTTCTCTTTTTCTGG + Exonic
999259448 5:150229001-150229023 AAGCTGTCTTTCCCATCTCCAGG + Intronic
1002933432 6:1651006-1651028 GAGCTGGCCCTGCCTTCTCAGGG - Intronic
1003361258 6:5427965-5427987 GTGATGGCTCTCCCTTCTCCAGG - Intronic
1005176214 6:23047482-23047504 GAGCTCTCTTTTTCTTCTCCTGG + Intergenic
1005197560 6:23306485-23306507 GAGCTGCCTTTCCCTTCTTTTGG - Intergenic
1006837591 6:37008341-37008363 GGGCTGGCTCTCCCTGCTTCTGG + Intronic
1007513038 6:42389299-42389321 GGGCCAGCTTTCCCTTGTCCAGG - Intronic
1007836565 6:44678458-44678480 CAGCTGACTGTCCCTGCTCCAGG + Intergenic
1009600221 6:65788232-65788254 TAACTGGATTTCCATTCTCCAGG - Intergenic
1011165730 6:84443882-84443904 GAGCTGGCTTTCTCATTTCCTGG - Intergenic
1015715973 6:136192087-136192109 GGGCAGGCTCTCCCTGCTCCAGG + Exonic
1017289071 6:152713737-152713759 TCTCTGGCTTTCTCTTCTCCAGG + Intronic
1017295572 6:152789906-152789928 GAGCTGGCCTTTTCTCCTCCTGG - Intergenic
1017717745 6:157224180-157224202 CCGCTGGCCTTCTCTTCTCCAGG - Intergenic
1017970611 6:159309570-159309592 GAACTTGCATTCCCTTCGCCTGG + Intergenic
1021754751 7:23841510-23841532 GTGCTGGCTTTCCCTGATGCTGG + Intergenic
1021838454 7:24703442-24703464 GATCTGGCATTCCCTTCCCTGGG - Intronic
1022423682 7:30247234-30247256 GATCTGGCTTTCTCATCTGCGGG + Intergenic
1023653995 7:42401644-42401666 GAGCTCCATTTCCATTCTCCTGG + Intergenic
1026389243 7:69883093-69883115 GAACTGGCTTTCCCACCTTCTGG - Intronic
1029413508 7:100429715-100429737 GAGCGCGCGTTCCCTTCGCCCGG - Exonic
1032694926 7:134326989-134327011 GAGCTGGCTCATCCTTTTCCTGG - Intergenic
1032856828 7:135841978-135842000 AAGATGGCTTTGCCTTCTCTGGG + Intergenic
1033738451 7:144248614-144248636 TAACTGGCTTTCCCTGCTCCAGG - Intergenic
1033744600 7:144302340-144302362 TAACTGGCTTTCCCTGCTCCAGG + Intergenic
1034243532 7:149627074-149627096 GAACTGTCTTTTCCTTCTACTGG - Intergenic
1035733823 8:1873237-1873259 CACCAGGCTTTCCCGTCTCCCGG - Intronic
1036601813 8:10267897-10267919 AAACTGGCTTTACCTTCTCTAGG + Intronic
1038629743 8:29230473-29230495 GAGCTGGCTGTCCGTTGACCTGG - Intronic
1039383351 8:37106835-37106857 GTGCTGTCATTCCCTGCTCCTGG + Intergenic
1039462083 8:37753466-37753488 CATCTGCCTTTGCCTTCTCCCGG - Exonic
1041401980 8:57455965-57455987 AACCTGGCTTTGCCTACTCCTGG + Intergenic
1042324148 8:67511053-67511075 GAGGTGGCTGTCAGTTCTCCAGG + Intronic
1042526557 8:69770632-69770654 GAGCTGGCTTTCCCTGTTGAAGG - Intronic
1045551979 8:103180990-103181012 GAGCTGGCTTTCCTTTCTCTGGG + Intronic
1046678668 8:117142109-117142131 GAATTGGCATGCCCTTCTCCAGG + Intronic
1046934746 8:119874869-119874891 GAGCTGGGTTTTCTTTTTCCTGG - Intronic
1048015272 8:130491363-130491385 GAGCGGACTGTCCCTTCTCTTGG - Intergenic
1049170683 8:141158868-141158890 GAGATGGCCATCCCCTCTCCCGG - Intronic
1049649024 8:143755063-143755085 GCCCTGGCTATCCTTTCTCCTGG - Intergenic
1050010307 9:1179307-1179329 AAGATGGCTAACCCTTCTCCTGG - Intergenic
1050939551 9:11441515-11441537 TAGCTAGCTTTCCAGTCTCCTGG - Intergenic
1051591706 9:18782803-18782825 GCACTGCCTTTCCCTTGTCCAGG - Intronic
1052347960 9:27428917-27428939 AAGCTGGCTTTCCCACCACCTGG + Intronic
1052648413 9:31268907-31268929 GAGCTGCCTTCCCCTTCTGCAGG + Intergenic
1060211579 9:121713618-121713640 CAGCTGGCTTGTCTTTCTCCAGG + Intronic
1060301560 9:122377289-122377311 GGTCTGGCTTTCCCTTTTTCTGG + Intronic
1060492171 9:124093000-124093022 CACCTGGCTTTTTCTTCTCCTGG + Intergenic
1060792771 9:126497266-126497288 GATCTGGGGTTCCCTGCTCCTGG + Intronic
1061248621 9:129414029-129414051 GATTTGGCTTTTCCTTCCCCCGG - Intergenic
1061291457 9:129652644-129652666 CACCTGGCTTTACCTGCTCCCGG - Intergenic
1062031956 9:134365776-134365798 GGGCTGGCCCTCCCTTCCCCTGG - Intronic
1185449870 X:276256-276278 GGGCGGGCTGTCCCTCCTCCTGG + Intergenic
1185853789 X:3513377-3513399 AGTCTGGCTTTCCCTTTTCCTGG + Intergenic
1189354523 X:40300626-40300648 TAGCTGGGTTTCCCCCCTCCAGG + Intergenic
1189782725 X:44531542-44531564 GATTGGGCTTTCCCTTCTCTGGG - Intronic
1190997327 X:55622867-55622889 CAGCTGGCTTTCCTCTCTCCAGG - Intergenic
1192021838 X:67402296-67402318 GTGCTGGCTTTCCCTGATGCTGG + Intergenic
1192769630 X:74174118-74174140 GAGTTGGCATTAGCTTCTCCAGG - Intergenic
1193723569 X:85015963-85015985 GTGCTGGCTTTCCCTGATGCTGG + Intronic
1195068743 X:101260129-101260151 GAGTAGTCTGTCCCTTCTCCCGG - Exonic
1196938637 X:120753986-120754008 GAGCTGGCTTTCCATTTTAGAGG - Intergenic
1197724727 X:129768735-129768757 TAGCTGGCTTTCCTATCTCGGGG - Exonic
1199437490 X:147828873-147828895 GAGCTGGCTCTCTCTGCTCACGG - Intergenic
1200106535 X:153716403-153716425 GAGCAGGCATTTCCATCTCCAGG - Intronic