ID: 1147498214

View in Genome Browser
Species Human (GRCh38)
Location 17:40937605-40937627
Sequence ATAAAGAAGCAGTCTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147498209_1147498214 -1 Left 1147498209 17:40937583-40937605 CCAAGGTAAAGGTTAGGAATGAA 0: 1
1: 0
2: 1
3: 12
4: 173
Right 1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG 0: 1
1: 0
2: 1
3: 34
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147498214 Original CRISPR ATAAAGAAGCAGTCTGGGGG CGG Intronic
900644317 1:3702209-3702231 AGAGAGGAGCAGTGTGGGGGAGG - Intronic
901073721 1:6538690-6538712 AAAAACAAGCAGGCTGGGTGTGG + Intronic
901257412 1:7842210-7842232 ATAAAGAATGAGGCTGGGCGCGG + Intronic
901897569 1:12327482-12327504 ATAAAAAAGGAGGGTGGGGGTGG - Intronic
901991229 1:13115673-13115695 GTAAAGATGGAGTCTGAGGGGGG - Intergenic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903124930 1:21241324-21241346 AAAAAGAAACAGACTGGGTGCGG - Intronic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903413096 1:23162949-23162971 ATAAAGAATAAGGCTGGGTGCGG + Intronic
903632790 1:24789225-24789247 ATATAGAAACAGGCTGGGCGAGG + Intronic
904013764 1:27405279-27405301 CCAAAGGAGCAGCCTGGGGGAGG - Exonic
904967825 1:34392453-34392475 AGAAAGAAGCAGGCTGGATGAGG - Intergenic
906354285 1:45090666-45090688 ATAAATAAGCAAGCTGGGTGTGG + Intronic
907020023 1:51058553-51058575 AAAAAGAACCAGGCTGGGAGTGG - Intergenic
910187267 1:84557563-84557585 AAAAAGAAGGAGGCTGGGCGCGG + Intronic
910939832 1:92521256-92521278 AAAAAGAAGCAGTCTTGGCTGGG - Intronic
912812210 1:112803011-112803033 ACAAAGAAGCAGGCAGGGGCAGG - Intergenic
913160478 1:116140664-116140686 ATAATAAAGCAGGCTGGGCGCGG + Intergenic
915214944 1:154333923-154333945 ATAATGAAGCAGGCCGGGCGCGG - Intronic
915473749 1:156140503-156140525 ATATAGACCCAGTCTGAGGGTGG + Intergenic
915961478 1:160270440-160270462 ATAAAAAGGCAGTCTGGGCCGGG - Intergenic
916513708 1:165496327-165496349 TGAAGGAAGCAGTTTGGGGGTGG - Intergenic
916788654 1:168105276-168105298 TTAAACAAGCAGGCTGGGGCAGG + Intronic
917269541 1:173258166-173258188 ATAAAAAAGCAGGATTGGGGAGG + Intergenic
917956571 1:180105300-180105322 ATAAAGAAGAGGTCCGTGGGCGG - Intronic
920223936 1:204424517-204424539 ATGAAGTAGCATTTTGGGGGTGG - Exonic
920602865 1:207346725-207346747 AGCAAGATGCAGTCTGGGAGGGG + Intronic
921058850 1:211565520-211565542 AAAAAAAAACAGGCTGGGGGTGG + Intergenic
921517259 1:216110894-216110916 AGAAAGAGACAGTCTGGTGGTGG - Intronic
921862790 1:220056716-220056738 ATACAGAAGCAGGCTGAGCGTGG + Intergenic
922009211 1:221564287-221564309 ATAAAGAAGCAGCCTTGGCCGGG + Intergenic
922357934 1:224794645-224794667 ATCAGGAAGAAGTCTGGGTGTGG + Intergenic
922384983 1:225073462-225073484 TTAAAGAAGCAGTCTGGCCATGG + Intronic
922621223 1:226989739-226989761 ATAAAGAAGCAGCCTGGATGAGG + Intergenic
924560697 1:245154937-245154959 ATAAAGATCCAGACTCGGGGAGG - Intergenic
1062975079 10:1677127-1677149 ATAAAGGAGCAGGCTTGGAGTGG + Intronic
1063412254 10:5845574-5845596 AAAAAGAACTAGTCTGGGTGAGG - Intergenic
1064323470 10:14327764-14327786 ATAAACACACAGTCTGTGGGAGG - Intronic
1064861848 10:19835219-19835241 ATAAAAAACCTGTCTGGGTGCGG - Intronic
1065485485 10:26232791-26232813 ATGAAGAAGTAGTCTGGGCGTGG - Intronic
1065832391 10:29626732-29626754 ATAAAGAATCAGGCTGGGCGCGG + Intronic
1065931908 10:30487389-30487411 ATAAAGAAATAGGCTGGGTGTGG - Intergenic
1067462698 10:46469339-46469361 ATGCAGAATGAGTCTGGGGGAGG - Intergenic
1067624497 10:47915298-47915320 ATGCAGAATGAGTCTGGGGGAGG + Intergenic
1067827514 10:49588656-49588678 ATAAACAAGCAGTGGGGAGGGGG + Intergenic
1067973809 10:51001277-51001299 ATCAAGAAGGAGCCTGGAGGAGG - Intronic
1067983535 10:51115547-51115569 ATAAAGAAGAAGGCTGGGTGTGG + Intronic
1069542466 10:69305562-69305584 AAAAAGAAGAAGGCTGGGTGTGG + Intronic
1070526777 10:77302319-77302341 CTTAAGGAGCAGTATGGGGGTGG - Intronic
1071788360 10:88928374-88928396 ACAGAGAAGGACTCTGGGGGAGG + Intronic
1072595986 10:96872400-96872422 ATAAAGGAGGAGGCTGGGTGTGG + Intronic
1072953560 10:99869704-99869726 CTAAAGAAGCAGTCTGGCCATGG + Intergenic
1073167612 10:101471220-101471242 ATTAAAAAGCAGTCTGTGAGGGG + Intronic
1074559069 10:114519115-114519137 TTCAAGAGGCAGCCTGGGGGAGG + Intronic
1074968948 10:118519747-118519769 GTCAACAAGCTGTCTGGGGGAGG + Intergenic
1075733113 10:124648042-124648064 AGAATGCAGAAGTCTGGGGGTGG - Intronic
1076472684 10:130729752-130729774 ATAAAGAGGCAGTCTGGGCGTGG - Intergenic
1077500311 11:2907066-2907088 AGGAAGAAGGAGTCTGGGGTTGG + Intronic
1077947853 11:6921725-6921747 ATCCAGATGCAGTCTGGGGAAGG + Exonic
1078130652 11:8611565-8611587 AATAAGAAGCAGGCTGGGCGTGG + Intergenic
1078176226 11:8973315-8973337 AGAAAGCAGAAGTCTGGGGCAGG - Intergenic
1081633744 11:44706929-44706951 ATAAAGAAGCAGGTTGGATGTGG + Intergenic
1082060241 11:47853911-47853933 ATAAAGAAAAAGTCCGGGCGTGG - Intergenic
1083015748 11:59452108-59452130 AAAAAGAAACAGACTGGGTGTGG - Intergenic
1083440912 11:62675948-62675970 ATAAAGCAGCAGGCCGGGCGTGG + Intergenic
1083692232 11:64416667-64416689 ATAAAGAATGAGGCTGGGCGCGG + Intergenic
1083692833 11:64421092-64421114 ATTAAAAAACAGTCTGGGTGTGG + Intergenic
1085039254 11:73317375-73317397 ATAAAGAAGCAGGCTCAGAGTGG + Intronic
1085544241 11:77302110-77302132 ATAAAGAGGTAGCCTGGGCGTGG - Intergenic
1085648263 11:78242870-78242892 ATACAAAATCAGTCTGGGTGTGG + Intronic
1085778482 11:79387712-79387734 ATAAACAAACAGGCTGGGTGTGG + Intronic
1086259075 11:84916053-84916075 ATTAAGAAGCAGGCCGGGCGCGG + Intronic
1086381770 11:86262170-86262192 AAAAAAAAGCAGGCTGGGTGTGG - Intronic
1086490869 11:87356660-87356682 ACAAAGCTGCAGTCTGAGGGAGG - Intergenic
1088029173 11:105225162-105225184 AGAAAGAAGCTGTTGGGGGGAGG - Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088632276 11:111785208-111785230 ATAAGGAAACAGGCTGCGGGTGG - Intronic
1089175111 11:116542923-116542945 ATGAAGAAGCAGTCCGGGAGAGG + Intergenic
1089269111 11:117289339-117289361 AGAAAGAAGCACTCTGCTGGCGG - Exonic
1089485178 11:118839968-118839990 ATAAACATGCAGGCTGGGCGCGG + Intergenic
1090056018 11:123425786-123425808 TTAGAGAAGCAGTGTGGAGGAGG - Intergenic
1090338703 11:125995499-125995521 ATAAAGAGGCACTGTGTGGGCGG + Intronic
1090640618 11:128726298-128726320 ATAGAGTAGGAGTCTGGGGCTGG - Intronic
1090870915 11:130746880-130746902 ATAAAGAAACTTTTTGGGGGTGG - Intergenic
1091100141 11:132864226-132864248 ATAAAAAATCAGGCTGGGTGCGG - Intronic
1094604061 12:31935577-31935599 AAAAAAAAGCTGTCTGTGGGTGG - Intergenic
1094655356 12:32414260-32414282 AAAAAGAAGTAGGCTGGGTGCGG - Intronic
1094758832 12:33503894-33503916 ATAAAAAACCAGGCTGGGTGCGG - Intergenic
1095565463 12:43618200-43618222 ATAAAGAAGGAGGCCGGGCGCGG - Intergenic
1095864010 12:46951710-46951732 ATAAAGAATGAGGCTGGGCGTGG + Intergenic
1096262595 12:50102483-50102505 ATAAAGGAGTGGTCTGTGGGAGG + Intergenic
1096453984 12:51770284-51770306 ACAAAGAAGCAGTGAGAGGGAGG - Intronic
1096497228 12:52045603-52045625 ATGAGGAAGCAGTCTTGGAGAGG + Intronic
1096635113 12:52953258-52953280 ATAAAGCAGCAGGGTAGGGGAGG - Intergenic
1096691469 12:53324770-53324792 TTAAATAAGCAGTATGGAGGAGG - Intronic
1097001046 12:55876903-55876925 AAAAAAAAGCAGGCTGGGTGTGG + Intergenic
1097003453 12:55897961-55897983 AAAAAGAAGAAGGCTGGGTGTGG + Intergenic
1097812062 12:64029704-64029726 TAAATGAAGCAGGCTGGGGGCGG + Intronic
1099544580 12:83962430-83962452 ATAAAAGAACAGTATGGGGGTGG + Intergenic
1099783893 12:87236453-87236475 AAAAAAAAGCAGGCCGGGGGCGG + Intergenic
1101606302 12:106249163-106249185 AGAAAGAAGCAGACTGAGTGAGG - Intronic
1103650362 12:122427204-122427226 ATAAATAAGCAAGCTGGGTGTGG + Intergenic
1103746454 12:123127897-123127919 AAAAAGAGGCAGGCTGGGCGCGG - Intronic
1104046022 12:125163595-125163617 AAAAAGAAGAAGGCTGGGTGCGG + Intergenic
1104550035 12:129748261-129748283 AGAAAGAAAGATTCTGGGGGAGG + Intronic
1104670627 12:130677683-130677705 ATACAAAACCAGTCTGGGGTGGG + Intronic
1105389995 13:19966729-19966751 AAAAACAAGCAGGCTGGGCGCGG - Intronic
1105449493 13:20486209-20486231 ATAAAGATGAAGGCTGGGTGTGG - Intronic
1106025282 13:25950093-25950115 AAAAATAAGCAGTCTGGGCTGGG - Intronic
1107885870 13:44873741-44873763 ATAAAGAAGCATTCTGTGAAAGG + Intergenic
1108313542 13:49218055-49218077 ATAAACCAGCAGCCTGGTGGTGG + Intergenic
1108355595 13:49626309-49626331 AAAAAGAAGCAGGCTGGGACAGG - Intergenic
1108394266 13:49978091-49978113 ATTAAGAACCAGCCTGGAGGAGG - Intergenic
1108562457 13:51659215-51659237 ATAAATAAGCAGGCTGTGCGCGG - Intronic
1108604926 13:52027965-52027987 ATAAAGCAGCAGGCTGGGTGTGG + Intronic
1108687851 13:52836295-52836317 GTAAAGGAACAGTCTGGGCGTGG - Intergenic
1108798651 13:54065886-54065908 ATAAAAAATCAGGCTGGGTGCGG + Intergenic
1109000016 13:56788217-56788239 ATAAAGAAGCAATCAGGCTGGGG + Intergenic
1109313325 13:60720796-60720818 ATAAAGCAGCAGTTTGGAAGGGG + Intergenic
1109799512 13:67358009-67358031 ATAAAGAAACAGGCCGGGCGCGG - Intergenic
1112485347 13:99814738-99814760 AAAAAAAAGGAGTCTGGGCGTGG + Intronic
1113531181 13:111028730-111028752 TTTAAGAAGCAGGCTGGGCGCGG + Intergenic
1113580925 13:111428363-111428385 ATTAAGGAGCAGTCTGCGGAAGG - Intergenic
1113811931 13:113148037-113148059 ATAAAAAAACAGGCTGGGTGTGG + Intronic
1115266544 14:31506579-31506601 ATAAAGAGGCAGTAAGAGGGAGG - Intronic
1115498554 14:34029623-34029645 GTAAACCAGCAATCTGGGGGTGG - Intronic
1115547823 14:34478997-34479019 AGACAGAAGCAGGCTGGGTGCGG - Intergenic
1116001094 14:39243573-39243595 ATGAAGAACCAGGCTGGGGGTGG + Intronic
1117160166 14:52981636-52981658 AAAAAGTAGCACTCTGGTGGAGG - Intergenic
1117803969 14:59470925-59470947 AGAAGGAACCAGTGTGGGGGTGG + Intronic
1118006378 14:61567805-61567827 ATAAGGCAGCAGCGTGGGGGTGG + Intronic
1119536400 14:75406313-75406335 ATAAGGAAGCAGCCAGAGGGAGG - Intergenic
1122552766 14:102558917-102558939 AAAAAGAAGCAGGCAGTGGGTGG - Intergenic
1123831669 15:24145505-24145527 ATAAAGAAGTACTCTGTGAGAGG - Intergenic
1125007242 15:34831446-34831468 ACAAAGAAACAGTCTGGGATGGG + Intergenic
1125106890 15:35982153-35982175 AAAATGAAGCAGTCTGGGTCCGG + Intergenic
1126034409 15:44533749-44533771 AAAAAGAAGAAGGCTGGGCGCGG - Intergenic
1127495044 15:59502872-59502894 AAAAAGAAGCAGGCTGGGCAGGG - Intronic
1127587526 15:60393005-60393027 ATAAAGATGCAGTAGGTGGGTGG - Intronic
1129001063 15:72334323-72334345 ATAAAGAATGAGGCTGGGCGTGG - Intronic
1130006033 15:80099268-80099290 ATAAAGAAAAAGTCGGGGGGAGG - Intronic
1130516037 15:84626299-84626321 TGCAAGAAGCAGTCTGGGCGTGG + Intronic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1131822198 15:96284683-96284705 ATAAAGATGAGGTCTGGCGGAGG - Intergenic
1131926253 15:97387116-97387138 ATGAATAAGCAGCCTGGGTGTGG + Intergenic
1133024489 16:2982043-2982065 ATGGAGCAGCAGTGTGGGGGAGG + Intergenic
1134643702 16:15849740-15849762 AAAATGAAGCAGCCTGGGCGCGG - Intronic
1135010624 16:18874573-18874595 AAAAAAAAGCAGGCTGGGCGCGG + Intronic
1135607622 16:23837025-23837047 ATAAAGACGCATTCAGAGGGAGG - Intronic
1136134763 16:28248870-28248892 ATAAAGAAGGAGGCCGGGCGTGG + Intergenic
1138150772 16:54654849-54654871 GTAAAGAAGCTCACTGGGGGTGG + Intergenic
1138826742 16:60329928-60329950 ATAAATAAACAGTCTGGGCGTGG - Intergenic
1139250774 16:65493325-65493347 TTAAAGGATCAGTCTGGTGGGGG + Intergenic
1140053669 16:71505579-71505601 ACAAACAAGCAGTTGGGGGGTGG + Intronic
1140825425 16:78701612-78701634 GGAAAGAAGGAGTGTGGGGGAGG - Intronic
1140954418 16:79849095-79849117 ATAAATCAGCAGGCTGGGGCTGG + Intergenic
1141181364 16:81755162-81755184 ATAAAGGAACAGGCTTGGGGTGG - Intronic
1141717667 16:85736099-85736121 ATAAAGCAACAGTCCGTGGGAGG + Intronic
1142064154 16:88050975-88050997 AGAAACAAGCAGGCTGGGTGTGG - Intronic
1142857465 17:2739388-2739410 ATAAACAAACAGGCTGGGCGCGG + Intergenic
1143332632 17:6148891-6148913 TTAGAGAAGGAGGCTGGGGGTGG - Intergenic
1144156136 17:12505346-12505368 TTCAAAAAGCAGTTTGGGGGAGG - Intergenic
1144930454 17:18854966-18854988 ATAAAGTTGCAGTCAGGTGGTGG + Intronic
1145122540 17:20273473-20273495 AAAAAGAAGAGGCCTGGGGGTGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146794697 17:35773110-35773132 TTGGAGAAGCAGTTTGGGGGTGG - Intronic
1147407686 17:40224539-40224561 TTAAAGAAGCAGGCTGGGCCGGG - Intronic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1147606218 17:41775240-41775262 AGACAGAAGAAGGCTGGGGGTGG + Intronic
1147616742 17:41833607-41833629 ATAAAGAAACAGGCCGGGTGTGG - Intronic
1148044863 17:44737177-44737199 ATTCAGTAGCAGTTTGGGGGTGG + Intronic
1149159330 17:53671984-53672006 AGAAAGAAGAAGTGTGGTGGGGG + Intergenic
1149572524 17:57683454-57683476 AGAATGAAGCAGTGTGGAGGTGG - Exonic
1149714246 17:58772166-58772188 ATATAGATGCAGGCTGGGCGCGG + Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150146219 17:62771865-62771887 ATTGACAAGCAGGCTGGGGGTGG - Intronic
1150191593 17:63246264-63246286 CTAAAGCAGCAGTCTGTGTGTGG + Intronic
1151496708 17:74462423-74462445 AAAAAGAATCAGGCTGGGCGTGG - Intergenic
1151633604 17:75328347-75328369 ATAAAAAAGGAGGCTGGGTGCGG + Intronic
1152086159 17:78220075-78220097 ATGAAGATGCAGTCTGGTAGGGG + Intronic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1154139320 18:11809272-11809294 AGAAAGCAGGAGGCTGGGGGAGG + Intronic
1154154605 18:11934121-11934143 AGAAAGAAACAGGCTGGGTGCGG - Intergenic
1154181789 18:12144846-12144868 TTAAAAAAGCAGTCTGGGCTGGG + Intergenic
1154182114 18:12146738-12146760 TTAAAAAAGCAGTCTGGGCTGGG - Intergenic
1155081992 18:22419506-22419528 ATAAAGAACTAGGCTGGGTGCGG + Intergenic
1155466565 18:26142293-26142315 ATAAAGTAGCATTATTGGGGAGG - Intronic
1155467549 18:26154903-26154925 ATAAAAAAGTAGGCTGGGTGTGG - Intronic
1155795264 18:30027445-30027467 AAAAAAAAACAGGCTGGGGGAGG - Intergenic
1156194661 18:34760552-34760574 CTAATGAAGCAGTCTGAGGAGGG + Intronic
1156694870 18:39753996-39754018 TTAAAGAAGCATTCTGGGCCAGG - Intergenic
1157730877 18:50003072-50003094 GAAAAGAAGCAGGCTGGAGGTGG + Intronic
1158171318 18:54603851-54603873 ATAAAAAAGAAGACTGGGTGCGG - Intergenic
1158890779 18:61870177-61870199 ATAAAGAAGCTGTGTCGGGATGG + Intronic
1159827140 18:73227296-73227318 AGAAAGAAGCAACCTGGGCGAGG - Intronic
1161078787 19:2300326-2300348 CTAAAGAATCAGCCTGGGGCCGG - Intronic
1161445490 19:4316509-4316531 ATAAAAAATTAGTCTGGGTGCGG - Intronic
1161569968 19:5025182-5025204 ATAAAGAAGAAACCTAGGGGTGG + Intronic
1161737585 19:6001156-6001178 AGAAAGAAACAGGCTGGGGATGG - Intronic
1162091566 19:8283679-8283701 ATGTAGATGCAGACTGGGGGTGG - Intronic
1162093803 19:8298528-8298550 ATGTAGATGCAGACTGGGGGTGG - Intronic
1163022003 19:14486924-14486946 ATAAAGAAGCGGGCCGGGCGCGG - Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163716454 19:18875253-18875275 AGAAAGAAACAGGCTGGGCGCGG + Intronic
1164477334 19:28585693-28585715 ACAGAGAAGCAGTCTGGAGCTGG - Intergenic
1165850290 19:38846329-38846351 CTCAAGAAGCCGTCTGTGGGTGG - Intronic
1166543048 19:43618321-43618343 ATAAATAAGTAGGCTGGGCGCGG - Intronic
1166588181 19:43969642-43969664 TTAAAGAAGCAGTCTGGGCCAGG - Intronic
1167242693 19:48354247-48354269 AAAAAGAAAAAGTCTGGGCGCGG - Intronic
1167529971 19:50009062-50009084 ATATAGAGGCAGACTGGAGGGGG + Intronic
1167634492 19:50646601-50646623 ATAAAAAAACAGTCGGAGGGAGG + Intronic
1167928708 19:52845712-52845734 ATAAAAAAACAGTCTAGGTGTGG + Intronic
1168368685 19:55812864-55812886 ATAAAGATGCAGCCTGGTGGTGG - Intronic
925275852 2:2647825-2647847 AGAGATAAGCAGTCTGGGGCTGG + Intergenic
926485751 2:13455159-13455181 ATAAAGGAGAACTCTGTGGGTGG - Intergenic
927124868 2:20004708-20004730 ATTAAGTAACATTCTGGGGGTGG - Intronic
927137852 2:20110462-20110484 ATGAAGTTGCAGTCTGGGGTTGG + Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928442704 2:31305230-31305252 AAAATGAAGCAGTCATGGGGAGG + Intergenic
928993492 2:37261194-37261216 ATAAAGATACAGGCTGGGTGTGG + Intronic
929521383 2:42654904-42654926 AGAAAGAAGGAGGCTGGGTGTGG - Intronic
929724393 2:44409030-44409052 ATATAGAAGCAGGCTGGGTGCGG - Intronic
930402103 2:50903473-50903495 TTATAGAAGTATTCTGGGGGAGG + Intronic
930980778 2:57523795-57523817 ATAAAGAAGAAGTGTAGGGTTGG + Intergenic
931039843 2:58285144-58285166 ATAAATAAGAAATATGGGGGTGG - Intergenic
931058114 2:58495438-58495460 ATAAAGGAGAAGTCAGGGGTAGG + Intergenic
931291817 2:60880923-60880945 AAAAAAAATCAGTCGGGGGGGGG + Intergenic
931671102 2:64648668-64648690 ATAGAGTGGCAGGCTGGGGGTGG - Intronic
931880875 2:66569384-66569406 AACAAGAAGCAGTCAGGAGGTGG + Intronic
932379646 2:71270344-71270366 TTAAAGAAGCAGTCTGGGCCGGG - Intergenic
933182787 2:79245950-79245972 ATGAAGAAGCAGGCTGGGTTTGG - Intronic
933236077 2:79866007-79866029 ATAAAAAAGCAGGCTGGCCGCGG - Intronic
933800189 2:85954351-85954373 ATAAAGAAACAGGCTTGGAGAGG + Intergenic
933967482 2:87442003-87442025 AGAAATGAGCAGGCTGGGGGTGG + Intergenic
934624720 2:95836363-95836385 TTAAAGAATCTGTCTGGGGCCGG + Intergenic
934987335 2:98897093-98897115 ATAAAGGAGCAGCATGGGGGAGG - Intronic
935263440 2:101374823-101374845 AAAAAGATGGAGGCTGGGGGAGG + Intronic
936326313 2:111508493-111508515 AGAAATGAGCAGGCTGGGGGTGG - Intergenic
938015965 2:127867454-127867476 AGAAAGAAGCTGGCTGGGTGTGG + Intronic
938199350 2:129360480-129360502 CTAGAGAAGCAGTGTGGGGAGGG - Intergenic
938916920 2:135951048-135951070 AAAATGAGGCAGCCTGGGGGAGG + Intronic
939535834 2:143427339-143427361 ATAAATAAGCAAACTGTGGGAGG - Intronic
939568200 2:143809843-143809865 AAAAATAAGCAGGGTGGGGGGGG + Intergenic
940036236 2:149314838-149314860 ATAAAGAGGCAGTCTGTGTGGGG + Intergenic
941264355 2:163341541-163341563 AGAAAGAAAAAGTCGGGGGGAGG + Intergenic
942651432 2:178172832-178172854 AAAAAGAAGCAAGCTGGGTGTGG - Intergenic
942958813 2:181805240-181805262 ATAAAGAAGAAGTATGGGCTTGG + Intergenic
943045928 2:182862411-182862433 AAAAAGAATGAGTCTGGTGGAGG - Intronic
943910123 2:193553739-193553761 AAAAAGTATCAGGCTGGGGGTGG + Intergenic
944442833 2:199760142-199760164 ATAAACCAGAATTCTGGGGGTGG + Intergenic
944631594 2:201631597-201631619 ATAAAGAATCAGGCAGGGGTGGG + Intronic
944635986 2:201676607-201676629 ATAAAAAAGTAGGCTGGGTGTGG + Intronic
945302788 2:208229923-208229945 AAAAGGATGCAGGCTGGGGGCGG + Intergenic
946942284 2:224782234-224782256 ATAAAAAAGGAGTTTGGGGGAGG - Intronic
947981991 2:234418525-234418547 AGAAAGAAGCAGGCAGGGGTGGG - Intergenic
948439480 2:237977549-237977571 ACAAAGGAGCACTCTAGGGGCGG - Intronic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1169433352 20:5559867-5559889 TTAAGGCAGCAGTCTGGAGGTGG - Intronic
1169535410 20:6533717-6533739 AAAAAGAAGCAGGCAGGGGTGGG - Intergenic
1170090216 20:12582492-12582514 ATCAAGAAACAGCCTCGGGGAGG + Intergenic
1170248433 20:14250324-14250346 GTAAATGAGCAGGCTGGGGGTGG - Intronic
1172028678 20:31967154-31967176 ACAAGGAAGCAGCCTGGGGCTGG - Intergenic
1172419630 20:34804351-34804373 ATAAATAAGCAAGCTGGGTGTGG + Intronic
1173331371 20:42078722-42078744 TGGGAGAAGCAGTCTGGGGGAGG - Exonic
1174449887 20:50613155-50613177 ATAAAGAAACAGGATGGGTGTGG + Intronic
1177743437 21:25181557-25181579 ATAAAGAATCAGGCTGGGCGCGG + Intergenic
1178343517 21:31805863-31805885 ATGCAGAGGCAGGCTGGGGGTGG + Intergenic
1178367804 21:32001997-32002019 ATAAAGAAGCAGTCGTAGTGAGG - Exonic
1178820208 21:35967972-35967994 AAAATGAAGCAGTCTGGGTGTGG + Intronic
1179976720 21:44872722-44872744 AGAAAGAAGCAGTGAGGGCGCGG - Intronic
1180090730 21:45532723-45532745 ATAGAGAAGCTGGCTGGGTGTGG - Intronic
1180204676 21:46251308-46251330 GTAAAGAAGCAGGCTGGGCTTGG + Intronic
1180208287 21:46276891-46276913 ATAAATAAGCAGGCTGGGTGCGG - Intronic
1181600900 22:23951407-23951429 ACACAGAAGCAGTCTGTGGAGGG + Intergenic
1181607613 22:23989919-23989941 ACACAGAAGCAGTCTGTGGAGGG - Intergenic
1181693147 22:24577280-24577302 ATGAAGAATAAGACTGGGGGTGG + Intronic
1181713250 22:24705003-24705025 ATAAACAAACTGTCTGGGAGAGG - Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182771366 22:32798979-32799001 ATGAAGATGCAGGCTGGGTGCGG - Intronic
1183720758 22:39560143-39560165 ATGATGAAGGAGACTGGGGGAGG - Intergenic
1184239290 22:43203580-43203602 ACAAAGGCGCCGTCTGGGGGAGG - Exonic
1184515768 22:44961243-44961265 ATAAAAAATCAGTCTGGGCACGG - Intronic
1185408319 22:50670046-50670068 AAAAAGAATCAGGCTGGGCGTGG + Intergenic
949315355 3:2748217-2748239 ATAAAGTTGCAATCTGGGGCTGG - Intronic
950331555 3:12159750-12159772 ACAAAGAAGCAGGCTGGGCGTGG + Intronic
950836162 3:15921147-15921169 AGAAAGAAACATTCTGGTGGCGG - Intergenic
950932964 3:16809321-16809343 AAAAAGAAAAAGTCTGGGGGTGG - Intronic
951206021 3:19926648-19926670 ATAAAAAAGCAGGCTGGGCGTGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952417674 3:33104299-33104321 ATAAAGAAATAGGCTGGGTGCGG - Intergenic
952836655 3:37608104-37608126 ATAAACAGGCACTCTGGGTGTGG + Intronic
953355589 3:42253820-42253842 ATGATGAGGCTGTCTGGGGGAGG + Intergenic
953712683 3:45287981-45288003 AGAGAGAAGCAGCCTGGGAGAGG - Intergenic
953960355 3:47261564-47261586 ATGAGGAAGCAGTCTAGGAGTGG + Intronic
954042056 3:47895989-47896011 TGAAAGAAGCAATCTGGGGTGGG + Intronic
954695954 3:52426246-52426268 AGAAAGAAGCTGGCTGGGTGTGG - Intergenic
955711739 3:61786586-61786608 ATACATACCCAGTCTGGGGGTGG - Intronic
955743556 3:62118331-62118353 TTACAGATGCAGTCTGTGGGTGG + Intronic
957690071 3:83555752-83555774 TTAAAGAAGCAGTCTGGGCTGGG + Intergenic
958650594 3:96931542-96931564 TTAAAGAAGCAGTCTGGCCATGG + Intronic
960011379 3:112837459-112837481 CAATAGAAGCAGTCTGGGGTGGG - Intronic
960516406 3:118607464-118607486 ATAAAAGAGCAGTTTGGGAGAGG + Intergenic
960632475 3:119746396-119746418 AAAAAGAAGCAGTCAAGGGCTGG + Intronic
960715236 3:120568681-120568703 AGGAAGAAACAGGCTGGGGGAGG + Intergenic
961986895 3:131144389-131144411 ATACAAAAGCAGATTGGGGGTGG - Intronic
962243766 3:133774012-133774034 ATTAAGAAGCTGGCTGGAGGAGG - Intronic
962389184 3:134957408-134957430 ATGAAGAAGGAGTCTGGGAGAGG + Intronic
963021915 3:140880014-140880036 ATAAATAAGTAATTTGGGGGAGG - Intergenic
963308258 3:143678114-143678136 ATGAAGAGGCAGGCTGGGCGCGG - Intronic
964211846 3:154237259-154237281 AAAAAGAAGCTGGCTGGGTGTGG + Intronic
964389209 3:156180232-156180254 ATAAGGAAGCAGACTTGGAGAGG + Intronic
966194497 3:177299601-177299623 ATAAAGATCCAGGCTGGGTGCGG + Intergenic
966196211 3:177316536-177316558 ATAAAAAATAAGTCTGGGTGTGG + Intergenic
966248052 3:177830893-177830915 ATAAAGAAGCAGCATGGGAGTGG + Intergenic
966260697 3:177975118-177975140 ATACAGAAGCAGGCTAGCGGGGG - Intergenic
967894234 3:194383813-194383835 ATTAAGGTGCAGCCTGGGGGAGG + Intergenic
967899859 3:194438644-194438666 GTAAGTAAGCAGGCTGGGGGTGG + Intronic
968877710 4:3282570-3282592 TTAAAAAAGCAGGCTGGGCGTGG - Intergenic
969272929 4:6115116-6115138 ATAAAAAAACAGGCTGGGTGTGG + Intronic
969359054 4:6649856-6649878 ATAAAAAAAAAGTCTGGGTGTGG - Intergenic
969377680 4:6773684-6773706 AAAAAGAACCAGGCTGGGCGTGG + Intergenic
971466048 4:26962039-26962061 CTAAAGAAGGAGGCTGGGTGTGG - Intronic
972332607 4:38077946-38077968 ACAAGGAAGAAGTCTGGGTGAGG + Intronic
973622177 4:52737862-52737884 CTGAAGAATAAGTCTGGGGGAGG + Intronic
974333891 4:60514956-60514978 AGAGAGAAGCAGTCTGGATGCGG + Intergenic
974889284 4:67860123-67860145 ATAAAGAAGCAGGGGTGGGGTGG + Intronic
975649560 4:76579176-76579198 ATAAATAAACAGGCTGGGCGTGG + Intronic
975998267 4:80341069-80341091 TCAAAGAAGCAGTCTGGGCCAGG - Intronic
976445601 4:85127347-85127369 GAAAAGCAGCAGTCTGGTGGAGG - Intergenic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
977006381 4:91572664-91572686 TTAAAGAAGCAGTCTGGGCTGGG + Intronic
977305367 4:95317686-95317708 AGAAGGCAGCAGACTGGGGGAGG + Intronic
978323209 4:107521269-107521291 ATAAGGAAACAGTCTCAGGGAGG - Intergenic
978458998 4:108929549-108929571 AAAAAGATGCAGGCTGGGCGTGG + Intronic
978826815 4:113034443-113034465 ATAAAGAAACCTCCTGGGGGTGG + Intronic
979096986 4:116563316-116563338 TTAAAGCAGCAGTCTGGCTGCGG - Intergenic
979527749 4:121735438-121735460 TAAAAGGAGCAGACTGGGGGTGG - Intergenic
982265297 4:153533273-153533295 ATTAAGAAGGAGGCTGGGTGCGG - Intronic
982966136 4:161910731-161910753 ATGAAGAAGCAAGCTGGGAGAGG - Intronic
983607541 4:169606961-169606983 ATAAAGCAGCAGTCTTGCTGAGG + Intronic
983829854 4:172313120-172313142 AAAAAAAAGAAGTGTGGGGGTGG - Intronic
983979970 4:173983587-173983609 ATAAAGAAAGAGGCTGGGTGTGG + Intergenic
986386856 5:7243131-7243153 AAAAAGGAGCAGTTTGGGGCAGG + Intergenic
988283014 5:29174048-29174070 ATAAAGAAGCATTCTGTGAAAGG + Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
991598084 5:68324702-68324724 ATATAGGAGGAGACTGGGGGCGG - Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992106638 5:73453465-73453487 CTGAAGAAGCAGGGTGGGGGAGG - Intergenic
996721080 5:126630909-126630931 ATAAATAAGCAAGCTGGGCGTGG - Intergenic
996953555 5:129156838-129156860 TTAAAGAAGAAGTCTGGGCATGG - Intergenic
997476997 5:134148717-134148739 AAAAAGATGCAGTCTTTGGGAGG - Intronic
997937397 5:138125210-138125232 ATAAATATACAGTCTGGGTGTGG - Intronic
998608655 5:143663906-143663928 TAAAAGAAGGAGTCTGGGTGTGG - Intergenic
998800125 5:145860761-145860783 ATAAAGAAACAGATTGGGAGAGG - Intronic
999824368 5:155259924-155259946 GTACAGAAACAGTCTAGGGGTGG - Intergenic
999824796 5:155263728-155263750 ATAAAGATGTAGTGTTGGGGTGG - Intergenic
1000098326 5:157990508-157990530 AAAAAAAAACAGTCTGGGTGCGG + Intergenic
1000354782 5:160384012-160384034 ATAAAGAAGGAATATGGGGCTGG + Intergenic
1001995130 5:176151270-176151292 ATAAAGAAACAGGCCGGGCGCGG - Intergenic
1002398478 5:178976443-178976465 ATGAATAAGCAGTCTGTGGGGGG + Intergenic
1003028530 6:2580013-2580035 ACAAGGAGCCAGTCTGGGGGAGG - Intergenic
1004678484 6:17868201-17868223 AAAAAAAAGCAGTCTGGTAGTGG - Intronic
1004700215 6:18071739-18071761 TTATAGAAGCAGACTGGGGTGGG - Intergenic
1005972600 6:30773126-30773148 AGAAAGAATCAGGCTGGGTGGGG + Intergenic
1006486667 6:34348485-34348507 AAAAAGAAACAGGCTGGGAGCGG + Intronic
1006635353 6:35457687-35457709 ATATACAAGCTGGCTGGGGGAGG + Intronic
1006948937 6:37805544-37805566 ATAAATAAGTAGGCTGGGCGTGG - Intergenic
1007503559 6:42316828-42316850 ATAAAAAGGCAAGCTGGGGGCGG - Intronic
1007603580 6:43099777-43099799 TTAAAGAATCTGGCTGGGGGTGG + Intronic
1007620479 6:43210515-43210537 ATTAATAAGCAGTCTGTCGGGGG + Intronic
1008298474 6:49805861-49805883 TTAAAGAAGCAGTCTGGGCCTGG - Intergenic
1008482587 6:52001719-52001741 AAAAAGAAGGAGGCTGGGCGTGG - Intronic
1009185071 6:60565189-60565211 AGAAAGACGTAGGCTGGGGGGGG - Intergenic
1010213477 6:73381688-73381710 ATAAAAAACCAGGCTGGGCGCGG + Intronic
1010388522 6:75310056-75310078 ATAAGGAAGCAAACTGGGGTTGG - Intronic
1010978102 6:82339391-82339413 CAAAAGATGCAGGCTGGGGGCGG - Intergenic
1011128240 6:84029570-84029592 ATGAAGAGGCAGCATGGGGGTGG - Intergenic
1011162065 6:84402690-84402712 TTTAAGAAGCAGGCTGGGTGCGG + Intergenic
1011685099 6:89817775-89817797 GTAAACAACCAGTCTGGGGCAGG + Intronic
1012099448 6:95012292-95012314 ATACAGAAACAGGCTGGGTGTGG - Intergenic
1012270044 6:97197905-97197927 ATAGAGATGCAGGGTGGGGGAGG - Intronic
1012572149 6:100742628-100742650 TTAAAGAAGCAGTCTGGCCATGG + Intronic
1013592550 6:111631582-111631604 AGAAAGAAGGAGGCTGGAGGGGG + Intergenic
1014044284 6:116866320-116866342 AGAAAAAAGCAGGCTGGGCGCGG - Intergenic
1014104117 6:117543846-117543868 ATAAGGAAACAGGCTTGGGGAGG - Intronic
1014733077 6:125057470-125057492 ACACAGTAGCAGTCTGGGTGTGG - Intronic
1015753609 6:136585805-136585827 TTAAAGAAGCAGTGTGGGCTGGG - Intronic
1015986430 6:138888602-138888624 AAAAAGAAGTAGGCTGGGCGCGG - Intronic
1017020398 6:150135502-150135524 ATATAGATCCAATCTGGGGGTGG - Intergenic
1017640890 6:156492754-156492776 AAAGAGAAGCATCCTGGGGGAGG + Intergenic
1018931103 6:168240966-168240988 ATAAAGAGGGTGTGTGGGGGAGG + Intergenic
1019455454 7:1124546-1124568 AGTAAGAGGCAGTCGGGGGGTGG + Intronic
1021753546 7:23828735-23828757 AAAAAGAACAAGTCAGGGGGTGG - Intronic
1022025457 7:26444101-26444123 ATAAAGAAGCAATAAGGGGCAGG - Intergenic
1022267809 7:28774655-28774677 ATAAATCAGCAGAGTGGGGGTGG + Intronic
1022535796 7:31097530-31097552 ATCAAGGAGCAGCTTGGGGGAGG - Intronic
1023514442 7:40987064-40987086 ATAATGATGGTGTCTGGGGGAGG + Intergenic
1024360444 7:48462445-48462467 ATAAGGAAACAGTAGGGGGGGGG - Intronic
1024504254 7:50148172-50148194 ATTTAGAAGCAGTGTGGGTGAGG + Intronic
1025625907 7:63221481-63221503 TTACAGAAACAGGCTGGGGGCGG + Intergenic
1025656208 7:63521654-63521676 TTACAGAAACAGGCTGGGGGCGG - Intergenic
1026225446 7:68436267-68436289 ATCAAGAAGCAGTGTGGGCCGGG - Intergenic
1026800883 7:73399112-73399134 ATAAATAAGCAAGCTGGGTGTGG - Intergenic
1027664948 7:81033791-81033813 ATAAAGATGAAGGCTGGGTGTGG - Intergenic
1028517986 7:91698951-91698973 CTGAAGAAGCAGTCTGGCTGTGG - Intronic
1029164450 7:98577315-98577337 AGAAAGAAACAGCCTGGGTGTGG + Intergenic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029480115 7:100807236-100807258 ATACAGGAGCAGGCTGTGGGTGG - Intronic
1029732005 7:102444648-102444670 AAAAAGAAGAAGCCTGGGGAAGG - Intronic
1030184945 7:106752369-106752391 ATAAAGAGGTTGTCTAGGGGAGG + Intergenic
1030352682 7:108507362-108507384 AAAAAGAAACAGGCTGGGTGAGG + Intronic
1030692185 7:112547195-112547217 CTAACGAAGCAGTCTGGCCGTGG + Intergenic
1031216161 7:118895003-118895025 AAAAAGGATTAGTCTGGGGGTGG + Intergenic
1031366924 7:120912715-120912737 ATAAAGAAGCATTATGGGCTGGG + Intergenic
1032462380 7:132121804-132121826 ATAAAGACTCAGGCTGGGTGGGG - Intergenic
1032583892 7:133129080-133129102 ATTAACAAGAATTCTGGGGGCGG + Intergenic
1033212359 7:139469448-139469470 ATAAATAAGTAGGCTGGGCGTGG - Intronic
1033974181 7:147079430-147079452 ATAAAGAAGGAGTCAGGCTGTGG - Intronic
1034134035 7:148749124-148749146 GGAAAGAAGTAGTCTGGGCGTGG + Intronic
1034519897 7:151611755-151611777 GTAAAAAAGCAGTCTCGGGCCGG + Intronic
1034713314 7:153216695-153216717 ATAAAAAAGCCCTCTGGGTGCGG + Intergenic
1035234712 7:157488802-157488824 ATAAATAAGCAAGCTGGGTGTGG + Intergenic
1035254807 7:157619429-157619451 AGAGAGGAGCAGCCTGGGGGAGG - Intronic
1036143125 8:6226221-6226243 AGAAAAAAGCAGGCTGGGTGTGG - Intergenic
1037512775 8:19600368-19600390 ATAGAGAAGTAGGCTGGGTGCGG - Intronic
1037523383 8:19701963-19701985 ATAAAGGAGCAATTTGGGGATGG - Intronic
1038081557 8:24142931-24142953 ACAAAGAAAAAGTCAGGGGGAGG + Intergenic
1038835536 8:31117081-31117103 GCAAAGAAGCAGTCTGGGCTTGG + Intronic
1040503113 8:48022424-48022446 AAAAAGATGCAGGCTGGGCGTGG - Intronic
1041065363 8:54077503-54077525 ATAAAAAAGTAGTCTGGGCACGG + Intronic
1042455595 8:68998801-68998823 ATAATAAAGCAGGCTGGGCGTGG - Intergenic
1042467559 8:69145151-69145173 ATAAAGAAGGAGTGTGGTCGAGG + Intergenic
1042553082 8:70011619-70011641 ATAAAGAATAAGGCTGGGTGTGG - Intergenic
1043926867 8:86046534-86046556 AAAAAGAATAAGTCTGGGGTGGG - Intronic
1044018307 8:87073804-87073826 CTAAAGAAGCAGTCTGGGCCGGG + Intronic
1045411070 8:101919958-101919980 ATAGAAAAGCAGTTTGGGGCTGG + Intronic
1045828026 8:106424226-106424248 GTAAAGAATCAGACTGGGTGTGG - Intronic
1048539887 8:135333046-135333068 ACAAGGAAGCAGTCATGGGGAGG - Intergenic
1049850709 8:144828719-144828741 TTCACGAAGCAGTCTGGCGGAGG - Intronic
1050394223 9:5178163-5178185 TTAAAGCAGCAGTCTGAGCGTGG - Intronic
1050731310 9:8713007-8713029 TTAAAGAATCAGGCTGGGTGCGG - Intronic
1052271632 9:26633785-26633807 ATAATGAAGCAGGCCGGGCGCGG - Intergenic
1053243412 9:36515536-36515558 ATAATAAAGCAGGCTGGGTGTGG + Intergenic
1055162189 9:73143481-73143503 GTAAAGAAACAGTCTAGGAGGGG + Intergenic
1055738825 9:79363339-79363361 ATTAAGAAGCTGGCTGGGTGCGG + Intergenic
1056825871 9:89875959-89875981 AGAAAGAAGGAGGCTGGGTGCGG + Intergenic
1058033446 9:100224902-100224924 AGAAAGAAGCAGGCCGGGTGCGG - Intronic
1058047473 9:100372101-100372123 AGAAAGAAGCAGTCTGAGTGAGG - Intergenic
1058644047 9:107114143-107114165 CTGAAGAAGCACTCTGGGGCTGG - Intergenic
1060035196 9:120249418-120249440 ACAAAGCAGCAGTTTGGGGAGGG - Intergenic
1060649218 9:125310826-125310848 AAAAAGAAGAAGGCTGGGCGCGG - Intronic
1060859056 9:126938947-126938969 TGAAAGAAGCAGGCTGGGTGTGG + Intronic
1061048351 9:128179627-128179649 AAAAAGAAACAGTCTTGGGCTGG - Intronic
1061755596 9:132809869-132809891 ATAAATAAGCAGGCTGTGGTCGG + Intronic
1186483548 X:9914739-9914761 ATAATAAAGCAAACTGGGGGCGG + Intronic
1186822373 X:13303700-13303722 AATAAGAAGCAGTCTTGTGGAGG - Intergenic
1187162959 X:16781306-16781328 CTAAAGAAGCAATGTGGGGCTGG - Intergenic
1187646143 X:21348990-21349012 TTAAAGAAGCAGTCTGGGCCGGG - Intergenic
1188177439 X:27009045-27009067 ATATAGAATAATTCTGGGGGTGG - Intergenic
1188703695 X:33299598-33299620 AGAAAGATACAGTCTAGGGGTGG + Intronic
1189856858 X:45232350-45232372 GGAAGGAAGCAGTCTGGGGCAGG - Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190087687 X:47409937-47409959 ATGAAGAAGGAGGCTGGGCGCGG - Intronic
1190137167 X:47807654-47807676 CTAAAGGAGCAGCCCGGGGGAGG + Intergenic
1190766347 X:53478916-53478938 AGAATGAAGCAGGCTGGGTGTGG + Intergenic
1190770749 X:53512192-53512214 AAAAAAAAGCAGGCTGGGTGTGG + Intergenic
1191099559 X:56711000-56711022 TTAAAGAAGCAGTCTTTTGGTGG + Intergenic
1191986528 X:66987434-66987456 TTAAAGAAGAAATCTGGGTGGGG + Intergenic
1193140492 X:78021902-78021924 AGAAAGAATCAGTCGGGGGTAGG - Intronic
1193300150 X:79880074-79880096 ATAAAGAAGTAGGCTAGGCGCGG + Intergenic
1193344948 X:80394682-80394704 ATAAATAAGCAGGCTGGGCATGG - Intronic
1193806195 X:85997657-85997679 GTGAAGAAGCTGGCTGGGGGCGG + Intronic
1194711862 X:97245291-97245313 ATAAATAAGCAAGCTGGGTGCGG - Intronic
1195004483 X:100672361-100672383 AGAAGGAAGCAGGCTGGGTGGGG + Intergenic
1195079638 X:101358708-101358730 AAAAAGAAGCTGTCTGTAGGAGG + Intronic
1195933840 X:110106718-110106740 ATAAAGACTCACTCTGGGAGAGG - Intronic
1196436184 X:115676686-115676708 ATAAAGAAGCAGCTTGGGTACGG + Intergenic
1196468912 X:116003011-116003033 ATACAGAATCAATCTGGAGGAGG - Intergenic
1196642165 X:118074727-118074749 ATAGTGAAACAGTTTGGGGGTGG - Intronic
1196647855 X:118137191-118137213 ATAGAGACCCAGTCTGTGGGGGG - Intergenic
1197722279 X:129753350-129753372 ACAAAGAAGCAAGCTGGGCGCGG + Intronic
1197948707 X:131871256-131871278 AGAAAGAAACAGGCTGGGCGCGG + Intergenic
1198202561 X:134436479-134436501 AAAAAAAAGCAGGCTGGGCGCGG - Intergenic
1201765685 Y:17571669-17571691 CAAAAGAAGCAGTCTGGGCTTGG + Intergenic
1201835867 Y:18334320-18334342 CAAAAGAAGCAGTCTGGGCTTGG - Intergenic