ID: 1147505720

View in Genome Browser
Species Human (GRCh38)
Location 17:41015356-41015378
Sequence CTAAATAAGCAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147505715_1147505720 14 Left 1147505715 17:41015319-41015341 CCTCAATAAATGATTCTAATAGG 0: 1
1: 0
2: 1
3: 22
4: 168
Right 1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG 0: 1
1: 0
2: 5
3: 23
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147505720 Original CRISPR CTAAATAAGCAGAGGGAGGC TGG Intronic
903019458 1:20383836-20383858 CTAAATTAGGAGTGGGAGCCAGG + Intergenic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
905155064 1:35970716-35970738 ATAAATAAACAAAGGGAGGGAGG - Intronic
905847514 1:41244737-41244759 CTAAAAAAGAAGCAGGAGGCTGG - Intergenic
906573308 1:46863185-46863207 CTAAAGAAGCATGGTGAGGCCGG + Intergenic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
907843814 1:58185225-58185247 CTAAAAAATGAGAGGGAAGCAGG + Intronic
909728749 1:78868546-78868568 CTAATTAATCTGAAGGAGGCAGG + Intergenic
910766512 1:90787961-90787983 ATGAACAAGCAGAGGGAGACAGG - Intergenic
913537978 1:119792606-119792628 ATAAATTAGGAGAGGGAGGTGGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
915449153 1:155992693-155992715 ATAAAGTAGCAGGGGGAGGCCGG + Intronic
915457230 1:156048842-156048864 CAAAATACCCACAGGGAGGCGGG - Intronic
915845089 1:159254460-159254482 CTTAAAAGGCAGAGTGAGGCTGG + Intergenic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
917770661 1:178274156-178274178 CTAAGAAAGCAGAAGAAGGCAGG - Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
918185842 1:182127191-182127213 CTTAATAAACAGAGGGTGGGGGG - Intergenic
918422066 1:184374230-184374252 CTCAAGAAGCTGAGGCAGGCCGG + Intergenic
919486565 1:198155134-198155156 CTAAATCAGAAGAGGGAGTAGGG - Intergenic
920142113 1:203823970-203823992 TTAAAAAAGGAGAGGGAAGCCGG + Intronic
920178871 1:204120372-204120394 GTAAATAAGCTGTGGGAGCCCGG + Intronic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923206755 1:231766561-231766583 CTAAATGAGCAGAGGAAGGGTGG + Intronic
1062876966 10:950632-950654 CTAAATAAAGAGAGAGACGCAGG - Intergenic
1063068639 10:2636660-2636682 CTAGATAAGGAAAGGGAGTCTGG - Intergenic
1063099384 10:2936130-2936152 CTAAAGAAGCGGAGCGGGGCAGG + Intergenic
1063112516 10:3048939-3048961 CTAAGTAAGAAGAGGGAGTCAGG - Intergenic
1065351559 10:24800132-24800154 CTAAATAAGGGAAGGCAGGCAGG - Intergenic
1065562156 10:26974634-26974656 ATAAACATGCAGAGGTAGGCCGG - Intergenic
1066452293 10:35541753-35541775 CTAAAGAAGAAAAGGGATGCTGG - Intronic
1066452302 10:35541817-35541839 CTAAAGAAGAAAAGGGATGCTGG - Intronic
1066452311 10:35541881-35541903 CTAAAGAAGAAAAGGGATGCTGG - Intronic
1066452332 10:35542009-35542031 CTAAAGAAGAAAAGGGATGCTGG - Intronic
1066452342 10:35542073-35542095 CTAAAGAAGAAAAGGGATGCTGG - Intronic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1067257723 10:44660775-44660797 GAAATTAACCAGAGGGAGGCGGG + Intergenic
1069681467 10:70288636-70288658 CCAAAAAAGTTGAGGGAGGCAGG - Intergenic
1071179572 10:82967369-82967391 ATAAATAAGCAACGGGAGGAGGG - Intronic
1072449735 10:95530447-95530469 TTCAATAAACGGAGGGAGGCAGG + Intronic
1073267199 10:102234872-102234894 TTATTTCAGCAGAGGGAGGCAGG + Intronic
1073943887 10:108729700-108729722 ATAAATAGGTAGAGGGAGGGAGG + Intergenic
1074997832 10:118773117-118773139 ATAGATAAGAAGAGAGAGGCTGG - Intergenic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075667084 10:124239390-124239412 TGAAATAAACAGAGGGAGGGAGG + Intergenic
1075910596 10:126122463-126122485 AAAAATAGGCAAAGGGAGGCAGG + Intronic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1077832882 11:5894458-5894480 TGAAATAAGCAGATTGAGGCAGG + Intronic
1078569033 11:12441730-12441752 CCAAATCTGCTGAGGGAGGCAGG + Intronic
1080194523 11:29593313-29593335 CTAAATAAGCACTGGGAAACAGG + Intergenic
1080889861 11:36400120-36400142 TTAAATAAGCAGAGGGAAAAAGG + Intronic
1082794036 11:57367307-57367329 CCAAATAAGCAGAGTGAGCTGGG + Intronic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1085016913 11:73179705-73179727 TTAAAAAATCAGAGGGAGGCTGG - Intergenic
1086720567 11:90116255-90116277 CTCTAGAAGCAGAGGGAGCCAGG - Intergenic
1089209320 11:116789889-116789911 CCAAATGAGCACTGGGAGGCTGG + Exonic
1091531202 12:1357472-1357494 CTAAATAAGCAGAAGCATTCTGG + Intronic
1092154770 12:6274915-6274937 CTAAATGAGCTCAGGGGGGCAGG - Intergenic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1093529879 12:20148063-20148085 CTATATAAAAAGAGGGAGCCAGG - Intergenic
1093600521 12:21015919-21015941 ATAAATAAGCTGAGGAAGGGAGG + Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1098302176 12:69065890-69065912 GTAAATAAACAGAGAGAGCCTGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1101758187 12:107637956-107637978 ATAGGTGAGCAGAGGGAGGCAGG + Intronic
1101914437 12:108885243-108885265 CTAAGTCTGCAGAGGGAGTCAGG + Intronic
1103068247 12:117918038-117918060 GGAAATAAGCAGTGGGAGGTGGG - Intronic
1107950355 13:45455744-45455766 CTATATAGGCTGTGGGAGGCTGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108350208 13:49585158-49585180 CTCAAAAAAGAGAGGGAGGCAGG + Intronic
1109241263 13:59892072-59892094 ATAAGTAAGCAGAGGGAGAAGGG + Intronic
1110464606 13:75786679-75786701 GAAAATAAGTAGAGAGAGGCCGG - Intronic
1111654499 13:91135050-91135072 TTAAATAATGAGAGGGAAGCAGG + Intergenic
1111995420 13:95160994-95161016 CTAAATATGCGGGGGGAGGGGGG - Intronic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1114201305 14:20523371-20523393 CTAAATAATGATGGGGAGGCTGG - Intergenic
1116381857 14:44278773-44278795 CAAAATAAGTAAATGGAGGCTGG - Intergenic
1116464044 14:45211965-45211987 TAAAAGAGGCAGAGGGAGGCTGG - Intronic
1118585877 14:67352679-67352701 CTAAATAAGGTAAGAGAGGCAGG + Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119678184 14:76572082-76572104 CTTAATAAGAAGATGCAGGCTGG - Intergenic
1120252657 14:82077968-82077990 CTCAACAATCAGAGGGAGGTAGG - Intergenic
1120534948 14:85683314-85683336 GTAAATAAAAAGAGGGAGCCAGG + Intergenic
1121005358 14:90487255-90487277 GTCACCAAGCAGAGGGAGGCTGG - Intergenic
1121351566 14:93177477-93177499 CTCTAAAAGCAGAGTGAGGCTGG + Intergenic
1121670614 14:95708176-95708198 TAAAATATGTAGAGGGAGGCTGG + Intergenic
1122226732 14:100285035-100285057 CTAAAAAAGCGGGGGGGGGCGGG + Intergenic
1122457571 14:101866187-101866209 CTAAATAAGAAAATAGAGGCTGG - Intronic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1122706818 14:103627085-103627107 CCAAATGAGAGGAGGGAGGCAGG - Intronic
1125374649 15:39015516-39015538 ATAAATAAACAGAGTAAGGCCGG - Intergenic
1125432135 15:39606035-39606057 CTAGATTAGCAGAGGGAGGGTGG - Intronic
1125936627 15:43641992-43642014 CTAAATAAGCATAGGAGTGCTGG - Intronic
1125949352 15:43738169-43738191 CTAAATAAGCATAGGAGTGCTGG - Intergenic
1126469213 15:48989287-48989309 CTAAATAAGCTGGGGGAGGAGGG - Exonic
1126712324 15:51472817-51472839 ATAAATAAGAGTAGGGAGGCTGG - Intronic
1127845712 15:62868763-62868785 CCAAATAAGGAGTTGGAGGCCGG - Intergenic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1128785809 15:70396052-70396074 CTCTATTAGCAGAGGGAGACGGG + Intergenic
1130721817 15:86394643-86394665 CTATAAAAGTAGAGGGAGCCAGG - Intronic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1133311623 16:4851075-4851097 CCAAATCAGCAGAGGAAGGAAGG + Intronic
1133987272 16:10677945-10677967 CTACATTAGCAAAGGCAGGCAGG + Intronic
1134821801 16:17252985-17253007 CTAAATGAGGAGATGGAGACAGG - Intronic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1134886298 16:17795733-17795755 TTAAATAAGCAGACACAGGCTGG + Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1137656145 16:50159534-50159556 AGAAATAAGCAGAGAGAGGCCGG - Intronic
1138477105 16:57277972-57277994 CTAAATGAGCAGAGGCTGCCGGG + Intronic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1146185856 17:30723734-30723756 CCCAATAAGAAGAGAGAGGCCGG + Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146255233 17:31388490-31388512 CCCACTAAGCAAAGGGAGGCAGG + Intergenic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147680018 17:42236912-42236934 GTAAATAAGCAGAAGATGGCGGG - Intronic
1147744114 17:42684627-42684649 AGAAAGAAGCAGAGGGGGGCCGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1147752697 17:42745939-42745961 CTTAAAAAGAAGAGGGAGGCCGG - Intergenic
1147789009 17:43001327-43001349 CTAAAGGGGCAGAGAGAGGCCGG + Intronic
1147901593 17:43789824-43789846 ATAAATTAACAGAAGGAGGCTGG - Intergenic
1148002341 17:44397236-44397258 GGAAAAAAGCAGAGGGAGGAGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791612 17:50176354-50176376 CTAGATATGGAGAGCGAGGCCGG + Intergenic
1148907515 17:50920646-50920668 GCAAATAAGCAGAAGGGGGCTGG - Intergenic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1152840735 17:82566504-82566526 CTTAATAAGCACTGGGCGGCAGG - Intronic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1155862116 18:30915127-30915149 GCAAATAAGCAGTGGGGGGCTGG + Intergenic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1157701493 18:49763838-49763860 CTGAATAACCAGCTGGAGGCAGG - Intergenic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1158154059 18:54405607-54405629 AAAATTAAGCAGGGGGAGGCAGG - Intergenic
1158509850 18:58080679-58080701 CTAAATAAGGAGCGAGAGGGTGG + Intronic
1158924554 18:62240891-62240913 CTAAATAAGGAGGGGGAGTTGGG + Intronic
1159095635 18:63898395-63898417 TAAAATATACAGAGGGAGGCAGG - Intronic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160903252 19:1439693-1439715 CTAAAAACGCAGGGGAAGGCAGG - Intronic
1160958606 19:1706842-1706864 CTCAAAAAGCAGAGGGGGGCCGG + Intergenic
1161956482 19:7498707-7498729 CTAAATAGGTAGAGGTAAGCAGG + Intronic
1162404507 19:10465514-10465536 ACAAATGAGCAGGGGGAGGCTGG - Intronic
1162972920 19:14191992-14192014 CCCAATAAGAAGAGAGAGGCCGG - Intronic
1164061463 19:21679173-21679195 CTACTAGAGCAGAGGGAGGCTGG + Intergenic
1164522180 19:28988105-28988127 CTAAATAACATGTGGGAGGCTGG + Intergenic
1164729877 19:30495489-30495511 CTGAACAAGCAGAGGCATGCTGG + Intronic
1165020550 19:32920778-32920800 CTATAAAATAAGAGGGAGGCTGG - Intronic
1165199756 19:34134343-34134365 CTAAATTTGCAGAGGGACCCAGG + Intergenic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925083821 2:1091915-1091937 CTAAATAGGCTGAGGGAGCCTGG - Intronic
925600000 2:5598555-5598577 CTAAATAAGGAGAGAGAGGTGGG + Intergenic
925778255 2:7356019-7356041 CTAAATCAGCAGAGCAAAGCTGG + Intergenic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
926817940 2:16819151-16819173 CTTTATAAGCAGAGAAAGGCTGG - Intergenic
928991406 2:37235951-37235973 CTAAATAAGCAAGGGGAGCCAGG - Intronic
929697162 2:44127969-44127991 CTAAAAAAACAAAGAGAGGCCGG + Intergenic
932603153 2:73144049-73144071 AAATATAAGCAGAGGGAGTCTGG - Intronic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
936590422 2:113798387-113798409 TTAAAAAAGCAAAGTGAGGCTGG - Intergenic
940024739 2:149193999-149194021 TTAAATAAGCAGAGAGAGATGGG - Intronic
940968191 2:159863740-159863762 CTACACAAGCATATGGAGGCAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944450165 2:199834459-199834481 CTAAGAAGGAAGAGGGAGGCAGG - Intronic
945950325 2:216033508-216033530 CAAAATAAGCAGAGAGAAACAGG + Intronic
947536385 2:230942627-230942649 CCAAAAGAGCAGAGGGAGGGTGG + Intronic
948764937 2:240214782-240214804 CTCACTAGGCAGAGAGAGGCTGG + Intergenic
1169376112 20:5067748-5067770 AAAAAAAAGCAGAGGGGGGCTGG - Intergenic
1169474872 20:5922506-5922528 AGAAATGGGCAGAGGGAGGCGGG + Exonic
1170701925 20:18711713-18711735 CTAAATAAGCACAATGAAGCAGG - Intronic
1171086585 20:22243570-22243592 CTAAAAAGGCAGAGGAAGGGAGG + Intergenic
1171515858 20:25734459-25734481 CTAAATAAACAGAGTGACGAGGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172685833 20:36753708-36753730 ATCAATAAGAAGATGGAGGCTGG + Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173348184 20:42220413-42220435 CCAAAAAAGAACAGGGAGGCAGG + Intronic
1174288958 20:49493555-49493577 ATAAATAAGAAGAGTGAGGCCGG - Intergenic
1174368326 20:50069727-50069749 CTAAAGAAGCTCAGGCAGGCAGG + Intergenic
1174372295 20:50099665-50099687 CTAAAGAAGCTGAGGGAGCTTGG - Intronic
1174416182 20:50368726-50368748 CTAAAGGAGTAGAGGGTGGCTGG - Intergenic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1177574304 21:22930965-22930987 ATAAATAAGTAGAGGGTGACTGG - Intergenic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178846433 21:36177677-36177699 CTAAATAAGAAGAGGAAGAGAGG + Intronic
1178882743 21:36461777-36461799 CTAATGAAGCCAAGGGAGGCGGG + Intronic
1179261201 21:39759568-39759590 CTGAAAAAGCTGAGGCAGGCTGG + Intronic
1180116181 21:45706698-45706720 CTAGCCAGGCAGAGGGAGGCAGG + Intronic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1182418978 22:30239490-30239512 CCAAATAGGCAGCGGGAGGAGGG + Intergenic
1182511984 22:30826404-30826426 CCAAGTAGGCAGAGGGAGGCTGG - Intronic
949895479 3:8764942-8764964 CTAAAGAAGCAAAGGGAAGTAGG + Intronic
953977179 3:47390646-47390668 CTAAAAAAGAAGAAAGAGGCTGG - Intronic
955677879 3:61468299-61468321 CTAAGTTAGTAGATGGAGGCAGG + Intergenic
958164059 3:89856452-89856474 CAAAATAATCCGAGGGAGGAAGG + Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
959081175 3:101802629-101802651 CTTAATAAGCATAGGAAGTCAGG + Intronic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
960723263 3:120645308-120645330 CCAAATATGCAGAGGAAGGTGGG - Intronic
961804023 3:129475969-129475991 CTATATTTGCAGAGGGAGGGGGG + Intronic
961993907 3:131220749-131220771 TTAGATATGCAGAGAGAGGCAGG + Intronic
962257932 3:133884979-133885001 CCAAATAACCAGAGGACGGCGGG + Intronic
962699889 3:137987389-137987411 CTAAATAAACAGTGGGAGAAAGG + Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963748997 3:149155571-149155593 CTAAATAAGAAGAGTGGGACAGG - Intronic
963923782 3:150930226-150930248 TTAGCTGAGCAGAGGGAGGCTGG + Intronic
964183180 3:153912517-153912539 CTAAATAAACATAGGGAGGCAGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967924945 3:194638673-194638695 GTAAAGAAGCAATGGGAGGCTGG + Intergenic
967937478 3:194740417-194740439 CAAAAAAAGCAGAGGGACGTGGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
970429073 4:15972082-15972104 CTTATTGAGCAGAGGGATGCTGG + Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971439545 4:26665532-26665554 CTAGATAAGTAGAGGAAGTCTGG + Intronic
972298954 4:37767152-37767174 CCAAAGAAGCTGAGGGTGGCAGG - Intergenic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
972422286 4:38899986-38900008 CTATCTAAGCAGAAAGAGGCTGG + Intronic
972733598 4:41818694-41818716 CTAAATCAGCAGTGGAAGACTGG - Intergenic
974406936 4:61485083-61485105 CAAAATACCCAAAGGGAGGCAGG - Intronic
975533435 4:75424331-75424353 CTTAAGAAACAGAGGAAGGCAGG - Intergenic
977428797 4:96904561-96904583 CTAAACATGGAGAGGGAGGGAGG + Intergenic
977963351 4:103111164-103111186 TCAAATAAGCAGAGGGAGTAAGG - Intronic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
980108778 4:128614751-128614773 GCAAAGAAGGAGAGGGAGGCAGG + Intergenic
980920688 4:139083421-139083443 TTAAATGAGCAAAGGGAGGCGGG + Intronic
980962701 4:139492139-139492161 CAAAACAAGCAGGGTGAGGCTGG - Intergenic
984767891 4:183413583-183413605 TGAAATACGCAGAGGCAGGCTGG - Intergenic
985969154 5:3361796-3361818 CTAAAGAATGAGAGGAAGGCAGG + Intergenic
987255094 5:16142622-16142644 CTAACAAAAAAGAGGGAGGCCGG - Intronic
991051750 5:62280122-62280144 ATCAATAAGCACAGGGAGACAGG + Intergenic
991294173 5:65063202-65063224 CTAGGTAAGCAGAGAGATGCTGG - Intergenic
991481794 5:67089247-67089269 TTAAACATGCAGAGGGAAGCAGG + Intronic
993060331 5:83030586-83030608 CTATTTAAGCAGTGAGAGGCAGG - Intergenic
994673043 5:102785252-102785274 CTTAATAAGAAAAGGGAGGGGGG + Intronic
994736684 5:103563987-103564009 ATAAAGAAGCATAGGGCGGCCGG - Intergenic
995759425 5:115547620-115547642 ATTAATAAGTAGATGGAGGCTGG - Intergenic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998506938 5:142679646-142679668 GTAAATAAGAGAAGGGAGGCTGG - Intronic
999911437 5:156205166-156205188 CCAGATAAGCAGAGGAAGTCTGG - Intronic
1002005974 5:176235426-176235448 CAAAAGAAGTAGAGGGATGCAGG + Intergenic
1002220405 5:177675206-177675228 CAAAAGAAGTAGAGGGATGCAGG - Intergenic
1002556905 5:180049041-180049063 TTAAATAAGCAGAGGCTGGTAGG + Intronic
1002792277 6:445337-445359 GTAAACAAGCAGAGGGAGGCAGG + Intergenic
1003254072 6:4459242-4459264 GTAGATAATCAGAGAGAGGCAGG + Intergenic
1004000861 6:11595882-11595904 GTCAAAAAGCTGAGGGAGGCGGG + Intergenic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005522004 6:26609967-26609989 CTAAATGGGCAGAGAGAGGATGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013626960 6:111948109-111948131 AAAAATAGGCAGAGGGAGGTGGG + Intergenic
1014319537 6:119909426-119909448 CTAAATTAGCAGAGGTAGAAGGG - Intergenic
1015507381 6:134003255-134003277 CTAGAAAAGCAGAGAGAGACAGG - Intronic
1015750582 6:136554457-136554479 GTAAATAAGAAAATGGAGGCTGG - Intergenic
1016747922 6:147600615-147600637 CTAAATGAGGAGAGGGAGAGTGG - Intronic
1016767577 6:147812022-147812044 CTAAAGAGGCAGAGGAGGGCAGG + Intergenic
1016943567 6:149506180-149506202 TTAAATAAGAAAATGGAGGCTGG + Intronic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1017386504 6:153891033-153891055 TTAAAAAAGCAGAGAGAGGCCGG + Intergenic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1018733188 6:166668675-166668697 CTGAAGAGGCACAGGGAGGCTGG + Intronic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1021760702 7:23900784-23900806 CTAAATAAATAAAGGGAGGGAGG - Intergenic
1022162628 7:27726936-27726958 CCAAAAAAAGAGAGGGAGGCAGG + Intergenic
1023878538 7:44306033-44306055 CCAAATACCCAGAGGGAGGGGGG + Intronic
1024394323 7:48848293-48848315 TTAAAAAAGCAAAGGGAGGGCGG - Intergenic
1024400943 7:48924352-48924374 TTAAAAAAGCAAAGGGAGGGCGG + Intergenic
1024585160 7:50835764-50835786 CTGAATAAGCACTGGGAGGTGGG - Intergenic
1025788286 7:64664232-64664254 ATAAACAGGCAGGGGGAGGCGGG - Intergenic
1026243693 7:68599288-68599310 CTACATAAGTAGATGGAGCCTGG - Intergenic
1026669836 7:72380337-72380359 CTTAAGAAACAGAGGTAGGCTGG + Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028726000 7:94088866-94088888 ATAAATACCTAGAGGGAGGCAGG + Intergenic
1029063506 7:97824330-97824352 TTAAAGAAGCAGAGGGGAGCAGG + Intergenic
1030125232 7:106146939-106146961 TGAAATATGCACAGGGAGGCAGG - Intergenic
1033455437 7:141498984-141499006 CTTAAAAAGCAGAGGGTGGTTGG + Intergenic
1033538948 7:142338462-142338484 CTGATTAAGCAAAGGGAGCCAGG + Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1037579837 8:20238629-20238651 CTCAGGAAGCAGGGGGAGGCAGG + Intergenic
1039024497 8:33242858-33242880 TTAGGTTAGCAGAGGGAGGCTGG - Intergenic
1039741848 8:40390014-40390036 CTAAATAAGAAGAGGGAAGCAGG - Intergenic
1041395142 8:57382856-57382878 ATATATAAAGAGAGGGAGGCAGG + Intergenic
1042822196 8:72942003-72942025 CTCATTAAGCAGAGGGCTGCAGG + Intergenic
1044861922 8:96532387-96532409 CTCAATAAGCAGAGAGACTCAGG - Intronic
1045685080 8:104703333-104703355 CTAATTAAGAAAAGAGAGGCAGG + Intronic
1047246952 8:123154530-123154552 GTAAAAATGCACAGGGAGGCAGG + Intergenic
1047638989 8:126797908-126797930 CTAAATAAGAAAAGGAAGTCAGG - Intergenic
1047711919 8:127561103-127561125 CACAACAAGCATAGGGAGGCGGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048798390 8:138172698-138172720 ATAATTATGCAGAGGGAGGGAGG + Intronic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1050044279 9:1527142-1527164 GGAAATAAGAAGAGGGAGGTTGG + Intergenic
1050756341 9:9008520-9008542 CTAAATAATGAAGGGGAGGCCGG - Intronic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1051613383 9:18982972-18982994 CTAAATCAGCAGAGGAAATCAGG + Intronic
1052238653 9:26245718-26245740 CCACATATTCAGAGGGAGGCTGG - Intergenic
1053246530 9:36538912-36538934 ATAAATAAGCACATAGAGGCCGG - Intergenic
1055679023 9:78695497-78695519 ATAAATAACCAGAGTGAGGGAGG + Intergenic
1056204038 9:84303300-84303322 CTAAAGAGGGAGAGGGAGTCTGG - Intronic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1056546468 9:87617838-87617860 CTAGAGAAGCAGAGGGGAGCAGG - Intronic
1056607493 9:88098613-88098635 CTAATCAAGTAGAGGGATGCAGG - Intergenic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1058730746 9:107847396-107847418 CTGAATAAGTTGGGGGAGGCTGG + Intergenic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1061928229 9:133818066-133818088 CAAAAAAGGCAGAGGGCGGCCGG + Intronic
1061948501 9:133922100-133922122 CAAACAAAGCAGAGGGAGCCGGG - Intronic
1186162392 X:6791544-6791566 CTAAAGTAGAAGAGGGAGACGGG + Intergenic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1187070490 X:15882710-15882732 CTAATTAAGGAGAGGGAGTTGGG + Intergenic
1192544733 X:72004274-72004296 CTAAATAGGCAGTGCGAGCCAGG - Intergenic
1192703887 X:73507831-73507853 TTAAATTAGAAAAGGGAGGCCGG - Intergenic
1195598954 X:106724537-106724559 CTAAAGTAACAGAGGGAGGGTGG - Intronic
1197690409 X:129494570-129494592 CTACAGAAGGAGAGGGATGCGGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199465403 X:148129933-148129955 CTAAATATCCAGAGGAAGGGAGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic