ID: 1147511253

View in Genome Browser
Species Human (GRCh38)
Location 17:41070662-41070684
Sequence CTGGCTTCACATTGCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147511249_1147511253 15 Left 1147511249 17:41070624-41070646 CCATCTGTTCATCCTTGTGTATT No data
Right 1147511253 17:41070662-41070684 CTGGCTTCACATTGCTACCATGG No data
1147511251_1147511253 3 Left 1147511251 17:41070636-41070658 CCTTGTGTATTGATTGGTGTATT No data
Right 1147511253 17:41070662-41070684 CTGGCTTCACATTGCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147511253 Original CRISPR CTGGCTTCACATTGCTACCA TGG Intergenic
No off target data available for this crispr