ID: 1147517864

View in Genome Browser
Species Human (GRCh38)
Location 17:41139221-41139243
Sequence TTTTTTATGAATATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 840
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 777}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147517864_1147517867 15 Left 1147517864 17:41139221-41139243 CCCTTCTCCATATTCATAAAAAA 0: 1
1: 0
2: 3
3: 59
4: 777
Right 1147517867 17:41139259-41139281 TTTATTTTTTTCAATACTTTTGG 0: 1
1: 1
2: 31
3: 308
4: 2560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147517864 Original CRISPR TTTTTTATGAATATGGAGAA GGG (reversed) Intergenic
900082838 1:872057-872079 TCTTTTATTAATATGTAGACAGG + Intergenic
901111406 1:6799238-6799260 TTTTTTAATTTTATGGAGAAAGG + Intronic
901132735 1:6972416-6972438 TTTTTTTTGCATCTGGAGAAAGG + Intronic
901257361 1:7841694-7841716 TTTTCTTTGAAAATGGAGATGGG - Intronic
901507840 1:9697198-9697220 TCTTTTATGAAAATAGAGACAGG - Intronic
901589512 1:10328503-10328525 ATTTTTATTAAAATTGAGAAAGG + Intronic
903727873 1:25464982-25465004 TTTTTTTTTAATATAGAGACAGG + Intronic
903898859 1:26627844-26627866 TAATTTATGAATTTGGATAAAGG + Intergenic
903948502 1:26979749-26979771 TTTTTTTTTGAGATGGAGAATGG - Intergenic
905203886 1:36331842-36331864 TTTTTGAGGAACATGGAGATAGG - Intergenic
905241254 1:36583028-36583050 ATTTGTATGTATGTGGAGAAAGG - Intergenic
906304756 1:44709903-44709925 CTGTTTATGAATTTGGAAAATGG + Intronic
906340360 1:44974302-44974324 TTTTTTATATATAGAGAGAAAGG - Intronic
906360426 1:45152577-45152599 TTATTTTTGCATATGGTGAAAGG - Intronic
906404263 1:45529062-45529084 TTTTTTGTGGAGATGGTGAAGGG - Intergenic
907157409 1:52347108-52347130 TTTTTTATGGAGAAGGAGAAAGG - Intronic
907427897 1:54392618-54392640 GTTTTAATGAAGATGGACAAGGG - Intronic
907591505 1:55676802-55676824 ATTTTTTTGTATATGGTGAAAGG + Intergenic
908080635 1:60574353-60574375 TTTTTGATGGCCATGGAGAAGGG - Intergenic
908202879 1:61815676-61815698 TTTTTTAAAAATATAGAGACAGG - Intronic
908382877 1:63613090-63613112 TTGTTTGTGTATATGGAGCATGG + Intronic
908974540 1:69881872-69881894 TTTTTTTTTAATCTGGAGACAGG - Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
910570384 1:88694843-88694865 TGATTTTTGAATATGGAGATAGG + Intronic
910696185 1:90018464-90018486 TATTTTAAGCATATAGAGAAAGG - Intronic
911001792 1:93173874-93173896 GTTTTTATGAGTATGGGAAAAGG + Intronic
911567855 1:99485154-99485176 CTTTTTATAAATATTTAGAAAGG + Intergenic
912075949 1:105875304-105875326 TTTATTATTATTATTGAGAAGGG - Intergenic
912426366 1:109595816-109595838 TTTTTTTTGAACATGTAAAAAGG - Exonic
912500398 1:110118078-110118100 TTTATTATGAAGATAGACAATGG + Intergenic
912614296 1:111082126-111082148 TTATTTTTGTATATGGAGAAAGG + Intergenic
912752625 1:112298435-112298457 TTTTTTTTTTCTATGGAGAAAGG - Intergenic
913675180 1:121133490-121133512 ATTTTTAATAAAATGGAGAATGG - Intergenic
914027018 1:143921110-143921132 ATTTTTAATAAAATGGAGAATGG - Intergenic
914788227 1:150852779-150852801 ATTTTGATGATGATGGAGAAGGG - Exonic
915735996 1:158085584-158085606 TCTTTAATGAATATGAAAAATGG - Intronic
915968387 1:160332623-160332645 CATTTATTGAATATGGAGAAAGG - Intronic
915975356 1:160382974-160382996 TCTTTTATGATTTTGGAGCAGGG - Intergenic
916433112 1:164751360-164751382 TCTTTTATGAATGTGTACAATGG + Intronic
916501032 1:165387061-165387083 TTCTTTTTGGAGATGGAGAAAGG + Intergenic
916548615 1:165828778-165828800 TTTTTTCTGCAGGTGGAGAAGGG + Intronic
916926713 1:169528953-169528975 TGTGTTATGAATATGTAGATAGG - Intronic
917433263 1:174993442-174993464 TATTTTAAGAAAATGGAGCAGGG - Intronic
917606034 1:176630537-176630559 TTTTGTAGAAGTATGGAGAATGG + Intronic
918487155 1:185042113-185042135 TTTTTTTTGGATATGGAGTCTGG + Intergenic
918674489 1:187265808-187265830 TTTTTTTTAAATCTGGAAAATGG - Intergenic
918707123 1:187678213-187678235 TTTTTTCTGTGTATGGAGACAGG - Intergenic
918902857 1:190447117-190447139 TTATTTGTGAATATGTAAAATGG + Intronic
920206838 1:204298473-204298495 TCTTTTCTGCACATGGAGAATGG + Intronic
920359058 1:205399817-205399839 TATTGAATGAATAGGGAGAAAGG + Intronic
920462542 1:206152328-206152350 ATTTTTAATAAAATGGAGAATGG - Intergenic
920689968 1:208138711-208138733 TTTTTTATGGAAATAGAGATGGG - Intronic
921329034 1:214016998-214017020 TTCTTTAAGAATGTTGAGAAAGG - Intronic
921671342 1:217927226-217927248 TTTTTTTGGAATGGGGAGAAAGG - Intergenic
921919976 1:220656907-220656929 TGTTTTATGAATTTGGGGGATGG + Intronic
922168124 1:223132604-223132626 TTTTTGGTGAATCAGGAGAAAGG + Exonic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
922960510 1:229642002-229642024 TTTTTTATGTTTCTGGAGACAGG - Intronic
923048399 1:230372361-230372383 TTTTGTATGAAGATCAAGAACGG - Intronic
923356987 1:233166968-233166990 TTTTTTTTAAATATAGAGATGGG - Intronic
923723420 1:236486178-236486200 TATTTGATGATTTTGGAGAAAGG + Intergenic
923987797 1:239401250-239401272 TTTTTGATGAAGCTGGAGAATGG - Intronic
924179009 1:241422933-241422955 TTTTTTTTTAATATAGAGATGGG + Intergenic
924530560 1:244890239-244890261 TTTATTATGTATATAGAGTATGG + Intergenic
924733345 1:246732188-246732210 TTTGTTATGTATTTGGAGATGGG + Intronic
1062760750 10:16047-16069 TCTTTTATTAATATGTAGACAGG + Intergenic
1063017361 10:2092435-2092457 TTTTTTAGGATTATGGAGATCGG - Intergenic
1063399607 10:5729844-5729866 TTTTTTTTGAAAATGAATAAAGG - Intronic
1063937222 10:11090424-11090446 TTTTTTATTAATTGGGAGGAGGG - Intronic
1064313354 10:14232096-14232118 TGATTTTTGTATATGGAGAAAGG + Intronic
1064666696 10:17660033-17660055 TTTTTTGATAATATGGAGAGGGG - Intronic
1064818866 10:19300684-19300706 TGGTTTTTGAATATGGAGTAAGG - Intronic
1064913460 10:20429025-20429047 TTATTTATGGATATTGACAATGG + Intergenic
1065509806 10:26467075-26467097 TTTTTTTTTAATATAGAGATGGG + Intronic
1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG + Intergenic
1066039967 10:31539274-31539296 TTTTTTTTGTATATGGTGTACGG + Intergenic
1066495476 10:35937910-35937932 TTTTATGTGGACATGGAGAAAGG - Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067345024 10:45431494-45431516 TTTATTGTTAGTATGGAGAAAGG - Intronic
1068493734 10:57757842-57757864 CTTTTTATGACTATTGTGAATGG - Intergenic
1068508309 10:57930858-57930880 TTTCTTATGAATAAGGGGAAAGG - Intergenic
1068872487 10:61960109-61960131 TTTTTCATGAATGTGTAGGAAGG + Intronic
1069115943 10:64506789-64506811 GTCTTTATCAATATGGAGAGAGG - Intergenic
1069132517 10:64724386-64724408 ATTTTCACTAATATGGAGAAAGG - Intergenic
1069178983 10:65332479-65332501 TTTTTTAGGAAAATGGACCATGG - Intergenic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069482688 10:68798005-68798027 TTCTTTAGGAATATGCAGGATGG + Intergenic
1070026930 10:72640688-72640710 TTTTTTTTAAATATAGAGATGGG - Intergenic
1070330322 10:75411801-75411823 TTTATTATGAGCATGGAGCATGG - Intergenic
1070431056 10:76338059-76338081 TTTTTTTTCTATAAGGAGAAGGG - Intronic
1070549240 10:77477606-77477628 TCTGTTATGAATATGGAGTTGGG + Intronic
1071008790 10:80913551-80913573 TTTTTTTTATATATAGAGAAAGG - Intergenic
1071114236 10:82198642-82198664 TGTTTTATGAATTTGAAGAGGGG - Intronic
1071232268 10:83602076-83602098 TTTTTTATTCATATGTAAAATGG - Intergenic
1071275057 10:84046181-84046203 TATTTTATAAATATGGTGGAGGG + Intergenic
1071698615 10:87904427-87904449 TTTCTTATAAATCAGGAGAATGG + Intronic
1071894129 10:90046222-90046244 TTATTTTTGTATATGGTGAAAGG + Intergenic
1072093231 10:92150261-92150283 TTTTTTTTTAATATAGAGATGGG + Intronic
1072275503 10:93818496-93818518 TCTTTCATGATTATAGAGAATGG - Intergenic
1072646677 10:97260920-97260942 TTTTTTTTAAATATAGAGATGGG - Intronic
1072814642 10:98493367-98493389 TTTCTTATCATTATTGAGAATGG + Intronic
1072839668 10:98757573-98757595 TTTTTTATGGCTATGGTGAATGG - Intronic
1072959301 10:99914719-99914741 TTTTGTAAGAAAATGGAGAACGG + Intronic
1073784655 10:106875598-106875620 GTTAGTATGAATATGGTGAAAGG - Intronic
1073891403 10:108106576-108106598 TGCTTTATGATTATGTAGAATGG - Intergenic
1074411919 10:113235839-113235861 TTGTGTAGGAATATGGACAATGG - Intergenic
1074606092 10:114969129-114969151 TTTTTTTTAAATATGGAACACGG + Intronic
1075352435 10:121735685-121735707 TTGTTCATGAATATGAATAATGG + Intergenic
1078290608 11:10006762-10006784 ATTTTGATCAATATTGAGAAGGG - Intronic
1078388375 11:10913064-10913086 TTTTTTTAGACTCTGGAGAATGG + Intergenic
1078535157 11:12167305-12167327 TATTTTATGAGTATGCAGCAGGG + Intronic
1078861660 11:15253639-15253661 TTTTTTAATAATATTCAGAAAGG + Intergenic
1078942851 11:16028402-16028424 TTTTCTATGAATATGGAGCTTGG + Intronic
1079373523 11:19871943-19871965 TGTTTGATGATCATGGAGAAAGG - Intronic
1079537246 11:21528982-21529004 TTTTCCCTGAATATGGAAAAGGG + Intronic
1079709587 11:23665309-23665331 TATTTTTTGTATATGGTGAAAGG + Intergenic
1079794400 11:24781604-24781626 TTTTTAAAGAAAATGGAAAATGG - Intronic
1080198080 11:29635096-29635118 ATTCTTATGAATACAGAGAAAGG - Intergenic
1080423176 11:32131121-32131143 TGTTTTTTGTATATGGCGAAAGG - Intergenic
1080440049 11:32285010-32285032 TTTTTTATGGCTATTGTGAATGG - Intergenic
1080818275 11:35779764-35779786 TTTTTTTTGTATATGGTAAAAGG + Intronic
1081267168 11:41039095-41039117 ATTTTTTTGTATATGGTGAAAGG + Intronic
1081281939 11:41220128-41220150 TTTTTTATGCATTAGGAGACAGG + Intronic
1082181600 11:49126788-49126810 TCTTTTATGTTTATTGAGAAAGG - Intergenic
1082581866 11:54880731-54880753 GTTTTTGTCAATTTGGAGAAAGG - Intergenic
1082754634 11:57062428-57062450 TTATTTTTGTATATGGTGAAAGG - Intergenic
1083184257 11:61008238-61008260 ATGTTTATGTATATGGCGAAAGG - Intronic
1083967399 11:66051214-66051236 TTTTTTATGTGTGTTGAGAAAGG - Intronic
1085500019 11:77011742-77011764 TATTTTTTAAATATGGTGAATGG - Intronic
1086057676 11:82666467-82666489 TTTTTAAAGAAAATGGATAAAGG - Intergenic
1086203943 11:84236033-84236055 TTTTTTAATAAAATGGAGAAAGG - Intronic
1086222221 11:84461759-84461781 TTTTTTTTCAGAATGGAGAAAGG + Intronic
1086599879 11:88619976-88619998 TTCTTTATGCATATGGCAAATGG + Intronic
1086825094 11:91486517-91486539 TTTTTTATTTATATGCATAACGG + Intergenic
1087238162 11:95744239-95744261 TATTTTATTGATATGGTGAATGG + Intergenic
1087536802 11:99457742-99457764 ATTTTTATAAATATGGCCAATGG + Intronic
1087636116 11:100703279-100703301 TTTTTGATGAAAATAGAGTATGG - Intronic
1087933442 11:104004172-104004194 ATTTTTATGAACCTGTAGAAGGG + Intronic
1088055541 11:105571914-105571936 CTTTTAATAAATTTGGAGAAAGG - Intergenic
1088324562 11:108588323-108588345 TTTTTTATTTTTATGGTGAATGG + Intronic
1089017257 11:115176360-115176382 TTTTTTATGAATGGGTGGAAAGG - Exonic
1089156069 11:116403509-116403531 TCTTTTATGAACATCTAGAAAGG + Intergenic
1089469823 11:118711712-118711734 TTTTTTCTTAATATAGAGACAGG - Intergenic
1089554019 11:119304924-119304946 TTTTTTAAGAATACGAAGTATGG - Exonic
1090685593 11:129114904-129114926 TTCTTTCTCCATATGGAGAATGG + Intronic
1090742562 11:129678379-129678401 TTTTTTATGGCTATTGAGAAAGG - Intergenic
1091117589 11:133028681-133028703 TTTTTTTTGTATATGGTGAGAGG - Intronic
1093247395 12:16756542-16756564 TTTTTTAACAATATGGCAAATGG - Intergenic
1093848852 12:24010925-24010947 TTTTTTTTGGAAATGGAGCATGG - Intergenic
1094087730 12:26612063-26612085 TCTCTTATAAATAAGGAGAAGGG - Intronic
1095305083 12:40629037-40629059 GCTTTTAGGAAAATGGAGAAAGG + Intergenic
1095737326 12:45571874-45571896 TTTTTGATGGAAATGAAGAAGGG - Intergenic
1096061620 12:48705442-48705464 TTTTTTTTAAATATAGAGACAGG + Intronic
1097375086 12:58833519-58833541 ATTTTCTTGAAGATGGAGAATGG - Intergenic
1098427889 12:70386606-70386628 TTTTTTAAGGAGATGGGGAAAGG + Intronic
1098517741 12:71397211-71397233 TTTTATACTAATATTGAGAAAGG - Intronic
1098712778 12:73786742-73786764 TTTATTACTGATATGGAGAAAGG - Intergenic
1098862569 12:75726573-75726595 TTTTTTTTAAATATGGAGTCTGG + Intergenic
1098865907 12:75763223-75763245 TTTTTTATTAATATGACAAAAGG - Intergenic
1099149664 12:79094636-79094658 TTTTCTATTAATATTGATAAAGG - Intronic
1099169500 12:79347051-79347073 TTTTTTTTGAACATGGACTAGGG + Intronic
1099432394 12:82603420-82603442 TTTATTTTGTATATGGTGAAAGG - Intergenic
1099616842 12:84946917-84946939 TGTTTTATGATTGTGGAGATGGG + Intergenic
1099728409 12:86465208-86465230 TTTTTTATTAATTTTGTGAAGGG - Intronic
1099869163 12:88324789-88324811 TTTTTTAAGCCTATAGAGAAAGG + Intergenic
1100033013 12:90215911-90215933 TTTTTTATGAATATTTGTAAAGG - Intergenic
1100131387 12:91498600-91498622 TTATTTATGAAAATGGAGGCCGG + Intergenic
1100675896 12:96867272-96867294 TTTTTTTTAAATAAAGAGAAAGG - Intronic
1101696440 12:107131746-107131768 TTTTTTACAAATATGGAATAAGG + Intergenic
1101883844 12:108644511-108644533 CTTTTTCTGAATATGATGAATGG - Intergenic
1101904299 12:108813700-108813722 TTTTTTTTTAATTTGGAGACAGG - Intronic
1102734172 12:115143286-115143308 TTTCTTATGGTTCTGGAGAATGG - Intergenic
1102844362 12:116163081-116163103 TTTTTTATGACTTGGGACAATGG + Intronic
1103509358 12:121464050-121464072 TTTTTTATTTATATAGAGATGGG - Intronic
1104237336 12:126951643-126951665 TTGTTTATAAATATAGAGACAGG - Intergenic
1105394192 13:20012950-20012972 TTTTATATGAATTTGAAGATTGG + Intronic
1105652845 13:22399449-22399471 TTTTTTTTAAAGAGGGAGAAAGG + Intergenic
1105681995 13:22737578-22737600 TTTTATGTGAAAATGAAGAATGG - Intergenic
1105951842 13:25235962-25235984 TTTTTAATGAAGATTAAGAAGGG + Intergenic
1105987310 13:25580530-25580552 TTTTTTTTAAATATAGAGACAGG + Intronic
1106278260 13:28236385-28236407 TTTTTTAAAAATATAGATAAAGG - Intronic
1106648524 13:31663837-31663859 TCTTTTGTAAATATGAAGAAGGG + Intergenic
1106731958 13:32551037-32551059 TGTATAATAAATATGGAGAAAGG + Intergenic
1107366712 13:39686899-39686921 TTTTTTTTTAATAATGAGAAAGG + Intronic
1107383806 13:39886657-39886679 TTTTGTATCAATATGCATAAGGG - Intergenic
1107629088 13:42325096-42325118 TTTTTTAAGTATGTGGAGAAGGG + Intergenic
1108331844 13:49394299-49394321 TTTTTTTTTATTATAGAGAATGG - Intronic
1108359788 13:49658638-49658660 TTTTTTATTTATATTGAGACAGG - Intergenic
1108494613 13:51012154-51012176 TTTTTTTTGTATATGGGGTAAGG + Intergenic
1108719075 13:53111522-53111544 ATTTTTGTGGATATGGAGAGGGG + Intergenic
1108897270 13:55347925-55347947 TATTTAAGTAATATGGAGAAGGG + Intergenic
1109313422 13:60721833-60721855 TTTTTTAAAAAAACGGAGAAAGG - Intergenic
1109321440 13:60814678-60814700 TTGTTTGTGAAAATGGAAAATGG - Intergenic
1109409429 13:61943742-61943764 TTTTTTTTTAATATGCAGGAGGG - Intergenic
1109450525 13:62508127-62508149 ATTTTTTTGTATATGGTGAAAGG + Intergenic
1109690959 13:65888062-65888084 TCTTTTAAGAATTTGGAGAATGG + Intergenic
1109789534 13:67229221-67229243 TAATTTGTCAATATGGAGAAAGG - Intronic
1109805917 13:67442690-67442712 TATTTTAAGTATATGGAGGATGG - Intergenic
1110117363 13:71836156-71836178 TTTTTTCTCAAGATGGTGAAAGG - Intronic
1110462238 13:75757720-75757742 TTTTCTATGACTATGAATAAAGG - Intronic
1110552205 13:76822626-76822648 TTTTATTTTAATACGGAGAATGG + Intergenic
1110907355 13:80908756-80908778 CTTTTTCAGAAGATGGAGAAAGG + Intergenic
1111203795 13:84976390-84976412 TTTTATATGAACATGAAAAAAGG + Intergenic
1111521526 13:89411318-89411340 TTTTTTTTGAAAATGCAGAAAGG - Intergenic
1111892330 13:94099338-94099360 TTTTTGATAAATATCAAGAAGGG - Intronic
1112270834 13:97967957-97967979 ATTTTTTTCAATATAGAGAAGGG + Intronic
1112664026 13:101547710-101547732 TTGTTTTTTAATACGGAGAAAGG + Intronic
1112782822 13:102920170-102920192 TTTTTTATGGCTATTGTGAATGG + Intergenic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1113545806 13:111148621-111148643 TTCTGTATGAATTGGGAGAATGG - Intronic
1114030846 14:18579267-18579289 TCTTTTATTAATATGTAGACAGG - Intergenic
1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG + Intergenic
1114798535 14:25743952-25743974 ATTTTTTTTAATATAGAGAAGGG + Intergenic
1115182449 14:30644998-30645020 TTATTTTTGTATATGGTGAAAGG + Intronic
1115202010 14:30863803-30863825 TTTTGTATGAAAAGAGAGAAGGG - Intergenic
1115619828 14:35130809-35130831 TTTTTTTTAAATATAGAGACAGG + Intronic
1115724761 14:36201059-36201081 TGTTTTATGATCAGGGAGAAAGG + Intergenic
1115923137 14:38400314-38400336 TTTTACAAGAAAATGGAGAAAGG + Intergenic
1116545093 14:46155394-46155416 TTTTTTATGATTCTGGAGGCTGG - Intergenic
1117127936 14:52651280-52651302 TTTTTTATTATTATTGAGAAGGG - Intronic
1117355789 14:54922594-54922616 TCTTTTTTTAATATAGAGAAAGG - Intergenic
1117785278 14:59277461-59277483 TTTTTTATTATTAAGAAGAAAGG - Intronic
1117804175 14:59473374-59473396 TTTTCAGTGAAGATGGAGAAGGG + Intronic
1117995257 14:61471981-61472003 TTTTTTCTGAGTTTGTAGAAAGG + Intronic
1118038989 14:61897552-61897574 TTTTTTCAGAATAAGGAGAATGG + Intergenic
1118239958 14:64046690-64046712 TCTTTTATGAGTCTGGTGAAGGG - Intronic
1118407270 14:65438060-65438082 TTTTATAATAATATGGAGAGAGG + Intronic
1118671738 14:68135901-68135923 TTTTTATAGAATATGGTGAACGG - Intronic
1118773225 14:68956292-68956314 CTTTTTATGAAAATGGAGACAGG - Intronic
1119764498 14:77180008-77180030 TTTTTTTGGCATATGGAAAATGG - Intronic
1120089999 14:80320516-80320538 TTTTTTATGTAGAAGGAAAATGG + Intronic
1120129655 14:80790268-80790290 TTCTTTTTTAATATGGATAATGG - Intronic
1120383293 14:83810532-83810554 TATTTTATGGTTATGGAGATAGG + Intergenic
1120900777 14:89573858-89573880 TTTTTTATTAAAATAGAGACAGG - Intronic
1120967580 14:90181306-90181328 TTTTTCATGATTCTGGAGACTGG + Intronic
1122455302 14:101845663-101845685 TTTTATTTGCATATGAAGAAAGG - Intronic
1122538991 14:102486288-102486310 TTTTTTTTTAATTTGAAGAATGG - Intronic
1122561559 14:102618724-102618746 TATTTTATGACCATGGAAAACGG - Intronic
1123574034 15:21647800-21647822 TTCCTTATAAATATGGAGAATGG - Intergenic
1123610650 15:22090385-22090407 TTCCTTATAAATATGGAGAATGG - Intergenic
1125180151 15:36873279-36873301 TTTTGTATGAATATGATAAATGG - Intergenic
1125315285 15:38424995-38425017 TCTTTTATGAATAGGGAAATAGG + Intergenic
1125402897 15:39322865-39322887 TTTCTTATGAATATGCAAAGTGG + Intergenic
1125637264 15:41199257-41199279 TTTTTTTTTAATATGGAGATGGG + Intronic
1126717852 15:51540199-51540221 TTTTTTTTGACAATTGAGAAAGG + Intronic
1126880223 15:53086514-53086536 TTTTTTTTTTGTATGGAGAAAGG + Intergenic
1127261963 15:57332943-57332965 TTTTCTGTGAATATGGGGATGGG - Intergenic
1127492225 15:59475970-59475992 TTTTTCATGATTCTGGAGACTGG + Intronic
1127609594 15:60623674-60623696 CTTTATGTGAATATGGACAAAGG + Intronic
1127621450 15:60738513-60738535 TATTTTTTGATTATGGAGAAAGG - Intronic
1127777878 15:62282545-62282567 TTATTTCTCAATATGGAGATAGG - Intergenic
1128010253 15:64287696-64287718 TCTTTTATGAAGATGGTTAAAGG + Intronic
1128175634 15:65553236-65553258 TTTCTTAGGAATAGTGAGAAGGG - Intronic
1128310473 15:66628833-66628855 GTGTTTATAAATATGCAGAAGGG + Intronic
1129555800 15:76507516-76507538 TTTTTTTTGAAAAGGGAGTAGGG + Intronic
1129819666 15:78590023-78590045 ATTTTTTTGATAATGGAGAATGG + Exonic
1129832527 15:78680021-78680043 TTTTCTAGGGATATGAAGAAGGG - Intronic
1130238315 15:82160652-82160674 TTTTTAACTAATATGGATAAAGG + Intronic
1130260744 15:82352562-82352584 TCTTTTAGGGATATGAAGAAGGG + Intergenic
1130280493 15:82516445-82516467 TCTTTTAGGGATATGAAGAAGGG - Intergenic
1130471864 15:84232628-84232650 TCTTTTAGGGATATGAAGAAGGG - Intergenic
1130479358 15:84347199-84347221 TCTTTTAGGGATATGAAGAAGGG - Intergenic
1130492412 15:84440930-84440952 TCTTTTAGGGATATGAAGAAGGG + Intergenic
1130537192 15:84795163-84795185 TTTATTAATAATTTGGAGAATGG + Intronic
1130594162 15:85237265-85237287 TCTTTTAGGGATATGAAGAAGGG - Intergenic
1131031400 15:89188870-89188892 TTTTTTTTTAATTTTGAGAAGGG - Intronic
1131044083 15:89298055-89298077 TGTTTTTTGACTATGGAGAGAGG - Intronic
1131091422 15:89627412-89627434 TCATTTATGCAAATGGAGAAAGG + Exonic
1131283465 15:91039385-91039407 TTTTTTACGGATATGAAGAAGGG + Intergenic
1132148794 15:99445214-99445236 GTCTTTATGAATATGTAGATTGG - Intergenic
1202982899 15_KI270727v1_random:382146-382168 TTCCTTATAAATATGGAGAATGG - Intergenic
1133471577 16:6081071-6081093 TTTTAAATGAATGTGGAGCATGG + Intronic
1133618871 16:7507050-7507072 TATTTTATGAATAAGGAAACTGG + Intronic
1133643400 16:7739632-7739654 TTTTATATGACTCTGGGGAATGG + Intergenic
1133969306 16:10555930-10555952 TTGTTTGGAAATATGGAGAAGGG - Intronic
1134317684 16:13134462-13134484 TTATTTCTGCCTATGGAGAAGGG + Intronic
1134369621 16:13610912-13610934 GTGTTTATGAATATGAAGATAGG - Intergenic
1134907343 16:17991649-17991671 TTTATTATGTAGATGAAGAATGG + Intergenic
1135243441 16:20831900-20831922 TGTTACATGAATATGGGGAAGGG - Intronic
1135542217 16:23339417-23339439 TTTTTTTTAAATATAGAGACAGG + Intronic
1136739501 16:32503435-32503457 ATTTTTATCTATTTGGAGAATGG + Intergenic
1137469977 16:48745478-48745500 TTTTTTTAGAAAATGGAGGAAGG + Intergenic
1139303704 16:65965805-65965827 GTTTTTATTAACATGAAGAAAGG - Intergenic
1139894585 16:70278205-70278227 ATTTTTATAAAAATAGAGAAGGG - Intronic
1140763939 16:78138635-78138657 TGTTTTATGACCATGCAGAAAGG - Intronic
1141258425 16:82426684-82426706 TTTTCTATGAAAAATGAGAAAGG + Intergenic
1203013717 16_KI270728v1_random:328361-328383 ATTTTTATCTATTTGGAGAATGG - Intergenic
1203032052 16_KI270728v1_random:601520-601542 ATTTTTATCTATTTGGAGAATGG - Intergenic
1203039669 16_KI270728v1_random:732911-732933 ATTTTTATCTATTTGGAGAATGG + Intergenic
1143077623 17:4357926-4357948 TTTTTTATAAAAATAGAGATGGG - Intronic
1143206790 17:5147884-5147906 TTATTTATTTATTTGGAGAAAGG + Intronic
1143569546 17:7747150-7747172 TTTTTTTTGAATGTGGAGACAGG + Intronic
1143997143 17:11016715-11016737 TTTTTTTTTAATATAGAGACAGG + Intergenic
1144001759 17:11061749-11061771 TTTTTGATGGATATTGAAAAAGG - Intergenic
1144157919 17:12525719-12525741 TTATTTATGAATAGCCAGAAAGG - Intergenic
1144251389 17:13420066-13420088 TTTTTTATGAATAGGGGGCAAGG + Intergenic
1144615790 17:16770474-16770496 TCTTTTCTGAATATGAAGGAAGG + Intronic
1144896912 17:18545198-18545220 TCTTTTCTGAATATGAAGGAAGG - Intergenic
1145135300 17:20399016-20399038 TCTTTTCTGAATATGAAGGAAGG + Intergenic
1146351560 17:32099418-32099440 ATTTTTAAGCAAATGGAGAATGG - Intergenic
1146466914 17:33093688-33093710 CATTTTCTGAATATGCAGAAAGG + Intronic
1146785826 17:35720592-35720614 TTTTTTTTTAATATAGAGATAGG + Intronic
1147517864 17:41139221-41139243 TTTTTTATGAATATGGAGAAGGG - Intergenic
1147968357 17:44206362-44206384 TTTGTTGTGAATCTGGAAAAAGG - Exonic
1148181938 17:45612490-45612512 TTTTTTTTTAATATAGAGATGGG - Intergenic
1148266919 17:46233202-46233224 TTTTTTTTAAATATAGAGATGGG + Intergenic
1148433828 17:47665413-47665435 TCTTTTATGAGTTTGGACAATGG - Intronic
1148940534 17:51206277-51206299 TATTTTTTTAAAATGGAGAATGG + Intronic
1149314731 17:55428292-55428314 TTTCTTGTGAATATGGAGAAGGG + Intergenic
1149357100 17:55851095-55851117 TATTTTATGAAAATGGACTAGGG + Intergenic
1149375004 17:56034935-56034957 GTTGTTTTGAAGATGGAGAAAGG - Intergenic
1149889340 17:60372667-60372689 TTTTTTTTTAATGTAGAGAACGG - Intronic
1149967323 17:61178473-61178495 GTTGTTATGAATATAGAGATGGG + Intronic
1150539509 17:66082215-66082237 TTTTTTAGTAATCTGAAGAAAGG - Intronic
1150718438 17:67593070-67593092 TTATTTTTGAATATGGAGTGAGG - Intronic
1150751609 17:67868708-67868730 ATTTTTAAGCAAATGGAGAATGG - Intronic
1151211963 17:72551111-72551133 TTTATTATTTATATGGAGTATGG - Intergenic
1151618227 17:75228741-75228763 CTTCATATGAACATGGAGAAGGG + Intronic
1151640445 17:75388610-75388632 TTTTTTTTTAATTTGGAGATGGG + Intronic
1152096441 17:78274710-78274732 TTTTTTAAAAATAGGCAGAAGGG + Intergenic
1203167256 17_GL000205v2_random:108981-109003 TTTTGCAGGAAAATGGAGAAAGG - Intergenic
1152953657 18:16401-16423 TCTTTTATTAATATGTAGACAGG + Intergenic
1153327894 18:3840409-3840431 TTGGTTGTGAAGATGGAGAAAGG - Intronic
1153745789 18:8178349-8178371 TTTTTAATGAAAATGGAGATTGG - Intronic
1154079792 18:11244884-11244906 TTTTTTATGATTTTGGAGGCTGG + Intergenic
1154402913 18:14059054-14059076 TAATTTTTGAATATGGTGAAAGG + Intronic
1155042810 18:22079100-22079122 TTTTTTCTGGATATGGGTAATGG + Intergenic
1155125177 18:22868039-22868061 TGTTCTATCAATATGGAGACAGG + Intronic
1155323086 18:24638134-24638156 TTTTTTATGGGTATGGGGCAGGG + Intergenic
1156147414 18:34201581-34201603 TATTTTATGTTAATGGAGAAAGG - Intronic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156279219 18:35617531-35617553 TGTTTGCTGAATCTGGAGAATGG - Intronic
1157017513 18:43735011-43735033 TTTTTCATTAATATGGTGCAGGG + Intergenic
1157193223 18:45598489-45598511 TTTTTTATTTTTATGGAGGAAGG - Intronic
1157240430 18:46004087-46004109 TTTTTTATAATTAAAGAGAAAGG - Intronic
1158093093 18:53738360-53738382 ATTTTTTTGGATATGGTGAAAGG - Intergenic
1158348725 18:56542156-56542178 TTTTTTTTTAATATGAGGAAAGG - Intergenic
1158637100 18:59169368-59169390 TTTTTTCTTAATATGGCTAAAGG - Intergenic
1158732212 18:60036394-60036416 TTTTTTTTGCATATGGTAAAAGG + Intergenic
1159023198 18:63160029-63160051 AGTTTTATGAATATTGACAAAGG + Intronic
1159262043 18:66026730-66026752 TTTTTTATGAATATGTATGTGGG - Intergenic
1159548193 18:69867136-69867158 TTTTATATGAATATAAATAAAGG - Intronic
1160560074 18:79750683-79750705 TTTTTTTTTAATGTGGAGATGGG + Intronic
1161647071 19:5459807-5459829 TACTTTATGGATATGGAAAATGG + Intergenic
1161906560 19:7161263-7161285 TTTTTTATATATATAGAGACAGG + Intronic
1162175251 19:8825577-8825599 TATTCTATAAATCTGGAGAAAGG - Intronic
1162207023 19:9063814-9063836 ATTTTTATAAAAATAGAGAAAGG - Intergenic
1162396144 19:10419074-10419096 TTTTTTTCAAATAAGGAGAAGGG + Intronic
1162695424 19:12470052-12470074 TTCTTTCTGAAATTGGAGAAAGG - Intronic
1164124986 19:22305401-22305423 TTTTTTATTATTATTGAAAATGG + Intronic
1164432821 19:28202805-28202827 TTTGTCATGAATACAGAGAAAGG + Intergenic
1164730835 19:30502954-30502976 ATTTTTATAATTATGGGGAAGGG + Intronic
1164814438 19:31184095-31184117 CATTTTATGAATATGTAAAAGGG + Intergenic
1165364371 19:35355828-35355850 TGTTTTATCAATATGGAAACAGG + Intergenic
1165680722 19:37772431-37772453 TTTTTTTTAAATATGGAGATTGG - Intronic
1167919500 19:52771286-52771308 TTTCTCATGAATCTGGAAAATGG - Intronic
925151158 2:1615970-1615992 TGATTTTTGAATATGGTGAAAGG - Intergenic
925916778 2:8612623-8612645 ATTTTTATTATTTTGGAGAAAGG - Intergenic
926511752 2:13790044-13790066 TTTTTTTTGAATAGGGAAACAGG + Intergenic
926734325 2:16061215-16061237 TTTTTTATAAATGTCAAGAAAGG + Intergenic
926980477 2:18561945-18561967 TTTCTTATGAGTAATGAGAATGG + Intronic
927346628 2:22051581-22051603 TTGGTTTTGAATATGGGGAAGGG - Intergenic
927995850 2:27485396-27485418 TGTATGATGAACATGGAGAACGG - Exonic
928002381 2:27535962-27535984 TTTTATATCCATATAGAGAAAGG + Intergenic
928591797 2:32824460-32824482 TTTTGAATGAATAGGCAGAAAGG - Intergenic
928776157 2:34766417-34766439 TTTTTTAAGATAAGGGAGAATGG + Intergenic
929087316 2:38181332-38181354 GTTTTAATGAGCATGGAGAAGGG - Intergenic
930321488 2:49859661-49859683 TTGCTTGTGAATATGGAAAAGGG + Intergenic
930695262 2:54405162-54405184 ATATTTATGAATATGGACTATGG - Intergenic
930706976 2:54514491-54514513 TTATCTCTGAATATTGAGAATGG + Intronic
931023500 2:58078843-58078865 TTTTTTATTATTTTAGAGAAAGG + Intronic
931095809 2:58939423-58939445 TTTTTTTGGAATGTGGGGAAGGG - Intergenic
931303110 2:61000590-61000612 TTTATTCTGAAGATGGAGGAAGG - Intronic
932069871 2:68609076-68609098 TTATTTTTGTATATGGTGAAAGG + Intronic
932597566 2:73103603-73103625 ATTTTTGCGAATATGGAGACTGG - Intronic
932850928 2:75185668-75185690 ATTGTTAGGAATATGGATAAAGG + Intronic
932906597 2:75760028-75760050 TTTGCTTTGAATATGGAAAATGG + Intergenic
932987331 2:76741713-76741735 TTTTTTTTGCATTTGGAAAAGGG + Intergenic
933011337 2:77068109-77068131 TTTTTCATAAATATAGAGACTGG + Intronic
933698988 2:85241002-85241024 GTTTTTAAGGAAATGGAGAAAGG + Intronic
934073784 2:88409936-88409958 TTTTTTATTTATATAGAGATGGG - Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
934964378 2:98707206-98707228 TTTTTTAAAAAAATGGAGACAGG - Intronic
935327455 2:101949609-101949631 TTGTTTTTGAATATGGAATAAGG - Intergenic
936408392 2:112229663-112229685 TTTTTTATGCATATATAGATTGG - Intronic
936523268 2:113225864-113225886 TTTTTTAAGAGTGTGGATAATGG - Intronic
936711674 2:115138659-115138681 TTTTTTATTAATAAGGACACAGG + Intronic
937384509 2:121415941-121415963 ATTTTTGTGAATCTTGAGAAAGG - Intronic
937421942 2:121764431-121764453 TTTGTTTTTAATATAGAGAAGGG - Intronic
937548143 2:123050589-123050611 TTTTATATGATTTTGGGGAAAGG + Intergenic
937816983 2:126261659-126261681 ATTTTTATGAAAATGGAGTTTGG + Intergenic
938380614 2:130834440-130834462 TTTTGCAAGAATATGGAGTAAGG - Intergenic
938497359 2:131806506-131806528 TGTTTTATTAATATGTAGACAGG + Intergenic
939247005 2:139638043-139638065 ATTTTTATGAATATGAATCATGG - Intergenic
939645330 2:144690536-144690558 ACTTTTGTCAATATGGAGAAAGG - Intergenic
939681945 2:145147084-145147106 ATTTTAATGAATTTGGAGCATGG - Intergenic
939839923 2:147174383-147174405 GTTTTTATGAGTTTGGAGAAAGG - Intergenic
939906511 2:147922811-147922833 TTTTTTAAGTATACGCAGAAAGG + Intronic
939923018 2:148140228-148140250 TTTTTCATGTATATTGACAATGG + Intronic
940445777 2:153775108-153775130 TTTTTTAAGAATAAGTAGATAGG + Intergenic
940479029 2:154204625-154204647 TATCTTATGGATTTGGAGAATGG - Intronic
940737494 2:157470022-157470044 ATTTTAATGAATATGAAGAGTGG + Intronic
940898869 2:159108165-159108187 TTTTCTCTGGATATGGGGAAAGG - Intronic
940900598 2:159123251-159123273 TTTTTTCTGTATAGGGCGAAGGG + Intronic
941087360 2:161133428-161133450 TTTATTGAGAATACGGAGAAGGG + Intergenic
941092133 2:161189813-161189835 TAATTTTTGTATATGGAGAAAGG - Intronic
941154854 2:161963913-161963935 ATTTTCTTGAATATGGAGACGGG - Intronic
941436848 2:165483165-165483187 GATTTTATGATTATGGAAAAGGG - Intronic
941715896 2:168763045-168763067 TATTTTATTTATATGGAGATAGG + Intronic
941721201 2:168814891-168814913 TTGTTTATGAAAATAGAGATGGG - Intronic
941767963 2:169318653-169318675 TTCTTTATAAATGTGGAGCAGGG - Intronic
942620689 2:177842544-177842566 CTGTTTAAGAATATGGAGCAGGG + Intronic
942770997 2:179520158-179520180 TTTTTTTTTAAGATGGAGACAGG - Intronic
943279385 2:185911804-185911826 TTTTTAAGGAATAAGGAAAAGGG - Intergenic
943585260 2:189731704-189731726 TTTTTTTTAAATATTGAGATGGG + Intronic
944093881 2:195945151-195945173 TTTTTGCTTAATATGTAGAAGGG - Intronic
944131427 2:196351660-196351682 TTTTTTAAGAAAATGTAGAGAGG - Intronic
944274567 2:197821337-197821359 GTATTTATAAATATGGAGAGTGG - Intronic
944488307 2:200230559-200230581 TTTTTGATGATTATGAGGAAAGG + Intergenic
944556521 2:200892560-200892582 TTTTTTATTCTTATGGAGTAAGG + Intronic
944969751 2:204978647-204978669 ATTTTTATGAATGTTGGGAAAGG - Intronic
945216094 2:207435775-207435797 TTTTTGATGTATATAGAGAAGGG - Intergenic
945365271 2:208945439-208945461 TTTTTTAGGTTTATTGAGAAAGG + Intergenic
945603600 2:211897933-211897955 TTTTTTTTAATTATAGAGAAGGG + Intronic
945629092 2:212249321-212249343 TTTTATATAATAATGGAGAATGG + Intronic
945695513 2:213098242-213098264 TTTCTTCTCAATATGTAGAATGG - Intronic
945793809 2:214336853-214336875 GTTTTTATAAATATTCAGAAAGG + Intronic
947280596 2:228448965-228448987 TTTATTCTGAAAATGGAAAAAGG - Intergenic
947283052 2:228478086-228478108 CTTTTTATAAGTATGGGGAAAGG - Intergenic
948415629 2:237801032-237801054 CTTTTTAAGAATATGAAGAGCGG + Intronic
948534420 2:238635369-238635391 TTTCATATGAGTTTGGAGAATGG + Intergenic
948923557 2:241079465-241079487 TTGTGTAGGAAAATGGAGAAGGG + Intronic
1168858986 20:1031559-1031581 TATTTTATGAATATATAAAATGG + Intergenic
1169634336 20:7671141-7671163 TTCTTTCTGAAAATGGAGACAGG + Intergenic
1172603929 20:36201907-36201929 TTTTCTCTGAGAATGGAGAAAGG - Intronic
1173326484 20:42038223-42038245 TATTTTATAAATAAGGAGATCGG + Intergenic
1173365282 20:42379585-42379607 CTTTGTAGGAATGTGGAGAAGGG - Intronic
1173696413 20:45018734-45018756 TTTTTTTTTAATTTGGAGACAGG + Intronic
1174073773 20:47917558-47917580 TTTTTTATAAACATGGAAATTGG + Intergenic
1174759023 20:53188121-53188143 GTTTTCATGAATTTTGAGAAGGG - Intronic
1174776170 20:53345189-53345211 GTTTTTGTGGATATGGAGCAGGG + Intronic
1175004615 20:55669000-55669022 GTTAACATGAATATGGAGAAAGG - Intergenic
1175088675 20:56483807-56483829 TATTTTATGAATATTCAAAAAGG - Intronic
1176404502 21:6350118-6350140 TTTTGCAGGAAAATGGAGAAAGG + Intergenic
1176432655 21:6638986-6639008 TTTTGCAGGAAAATGGAGAAAGG - Intergenic
1176904242 21:14480466-14480488 TTTTTTATGAATATGCATATTGG + Intergenic
1176930934 21:14809293-14809315 TTTTTTTTAAAAATGGAGACTGG + Intergenic
1177071632 21:16516350-16516372 CTTATTATGTACATGGAGAAAGG + Intergenic
1177147686 21:17424097-17424119 TAATTTATGAATCTGGATAAAGG + Intergenic
1177410890 21:20729178-20729200 TTTAATATGAACATGGAGAAAGG - Intergenic
1178045402 21:28688044-28688066 TTGTTGATGGATATGGTGAATGG + Intergenic
1178331054 21:31691767-31691789 TTTTTTTTAAATAGGCAGAAGGG - Intronic
1178734959 21:35140901-35140923 TTATTTATGATCAAGGAGAACGG + Intronic
1178820364 21:35969622-35969644 TATAATATGACTATGGAGAAGGG + Intronic
1180454960 22:15506323-15506345 TCTTTTATTAATATGTAGACAGG - Intergenic
1180737857 22:18031997-18032019 ATTTTTAGGAAAATGAAGAAGGG - Intergenic
1180752577 22:18134858-18134880 TTTTTCATGAATATGCAGTATGG + Intronic
1180978458 22:19865747-19865769 TTATTTAGGAAAATAGAGAAGGG - Intergenic
1181143733 22:20828105-20828127 ATTTTTGTGAATATTGTGAATGG + Intronic
1181828575 22:25540140-25540162 TTTTTTTTGTAATTGGAGAATGG + Intergenic
1182597254 22:31431339-31431361 TTTTTTCTGAATAGGAAAAAGGG + Intronic
949123913 3:422217-422239 TTTTTTTTTAATATAGAGACAGG - Intergenic
949253835 3:2020679-2020701 TTTTTTACTAATATTGAGAAAGG + Intergenic
951081368 3:18454003-18454025 TTTTTTAGAAATAAGGAAAATGG + Intergenic
951138499 3:19132220-19132242 TATTATATTAATATGGATAATGG - Intergenic
951320570 3:21239306-21239328 TTTTTTATGAAAATGTATTAAGG + Intergenic
951353971 3:21641645-21641667 TTTTTTTTTAATATAGAGATGGG + Intronic
951391979 3:22116793-22116815 GTTTTTATAAATATGATGAAAGG + Intronic
951752512 3:26053496-26053518 TGTTTTATGAAAAAAGAGAAAGG + Intergenic
951817778 3:26773842-26773864 CTTATTTTGAATATGTAGAATGG + Intergenic
952476228 3:33713350-33713372 TTTTTTATGCATATGTAACAAGG + Intronic
952542692 3:34383491-34383513 TTTTTTTTCAATCTGGAGACTGG + Intergenic
953293013 3:41685278-41685300 TTCTTTATGCTTAAGGAGAAAGG - Intronic
955023342 3:55142830-55142852 ATGTTTGTGTATATGGAGAATGG + Intergenic
955116412 3:56009322-56009344 TTTGTTATGAATATAAAGAATGG - Intronic
956042389 3:65158094-65158116 TTTTTTCTTAAGATGGAGAATGG - Intergenic
956058249 3:65323259-65323281 TTTTTTTTGAATCTGAAGGAGGG - Intergenic
956110150 3:65862119-65862141 TTCTTTATGAATACCCAGAAAGG + Intronic
956177987 3:66491871-66491893 TACCTTTTGAATATGGAGAAAGG - Intronic
956357552 3:68410691-68410713 TTTTTTTTGCTTATGGAAAATGG - Intronic
956562431 3:70594912-70594934 TTTGTTATGAAAATGGAGACAGG + Intergenic
957026141 3:75184200-75184222 TTTTTTGTTAATATGAACAAAGG + Intergenic
957183545 3:76912813-76912835 TTTTGTCTGAATTTGGAGAAGGG + Intronic
957239260 3:77637299-77637321 TTTTTTATTAGTTTGGGGAAGGG + Intronic
957331585 3:78771098-78771120 TAGTTTTTGAATATGGTGAAAGG + Intronic
957704632 3:83764189-83764211 TATTTTAGGAATTTGGTGAAGGG - Intergenic
957879315 3:86189593-86189615 TTCTTTTTGTATATGGTGAAAGG - Intergenic
957893124 3:86385801-86385823 TTTCTTATGCATAGTGAGAATGG + Intergenic
958627024 3:96639502-96639524 TTGTTGATGAAAATGGAGATAGG + Intergenic
959317542 3:104826853-104826875 TTTTTTATGTTTGTGGAAAAGGG - Intergenic
959469274 3:106729600-106729622 TTTTCTTTGAATATTGAGGAAGG - Intergenic
959508628 3:107183524-107183546 TAATATATGAATATGGAGACTGG - Intergenic
959610513 3:108289250-108289272 TATGTTATAAATATGAAGAAAGG - Intergenic
959854581 3:111135707-111135729 GATTTGATGAATATTGAGAAAGG - Exonic
960099339 3:113723312-113723334 TTTTTAAGGAATACTGAGAAAGG - Intronic
960302658 3:116023002-116023024 TTTTTTATGAGTGTGGTCAAGGG - Intronic
960374041 3:116876970-116876992 TTTTTTATCATTATAGATAATGG - Intronic
960644230 3:119860894-119860916 TTTGTTATGAGGATGGAGGAGGG + Intronic
961183024 3:124890880-124890902 TTTTTTATTAAGCTGGAGAGTGG + Intronic
962717336 3:138138019-138138041 TTTAGAATGAATATTGAGAAGGG - Intergenic
963662254 3:148141750-148141772 ACTTTTATGAAGAAGGAGAAGGG + Intergenic
964292426 3:155196137-155196159 TTTTGTGAGAATCTGGAGAATGG - Intergenic
965379981 3:167976432-167976454 ATTTTTATGCATAAGGAGAAAGG + Intergenic
966120919 3:176519197-176519219 TTTTGTATGAAAATGTAGATAGG - Intergenic
966256744 3:177925634-177925656 TGTTTCTTGAATATGGACAATGG + Intergenic
966586295 3:181629378-181629400 ATTTTTATGGATATGATGAAGGG - Intergenic
966662940 3:182434754-182434776 GTCTATATGAATTTGGAGAAGGG + Intergenic
967164525 3:186768647-186768669 TTTTTTTTAAATATAGAGATGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967588798 3:191247379-191247401 TTTTTCAGGAATCTGAAGAAGGG + Intronic
967660327 3:192100098-192100120 TTTTTTTTAAATATCAAGAAAGG - Intergenic
968012688 3:195295575-195295597 TTTTCTTAGAATATGTAGAAGGG + Intronic
968020641 3:195385232-195385254 TTTTTTTTGAATACAGAGATAGG - Intronic
969505085 4:7581180-7581202 TTTTTAATGAAAAAGGAAAAAGG + Intronic
969745743 4:9069751-9069773 TTTTTTTTTAAGATAGAGAAGGG - Intergenic
970735921 4:19167753-19167775 TTTTATCTGAAAATGGAGAGAGG + Intergenic
970798117 4:19939360-19939382 TTATTTATAAATATGAAGACTGG + Intergenic
971408759 4:26347639-26347661 TCTTTTAAGAACATGGAGAGTGG + Intronic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971630737 4:28989941-28989963 TATTTTAAGAATATGGATAAGGG + Intergenic
971874775 4:32292964-32292986 ATTTTTATGAATATTTAAAAAGG + Intergenic
971888001 4:32477658-32477680 TTCTTTATGAATTTGCAAAATGG - Intergenic
972134176 4:35871659-35871681 TTATTTAGAAATATGGAGTAGGG + Intergenic
972483379 4:39519224-39519246 TTTTTTTTTAATTTGGAGATGGG + Intronic
972857665 4:43126748-43126770 TTCTCTATGTATAAGGAGAATGG + Intergenic
972869365 4:43277611-43277633 TTTTTTCTGAAGTTAGAGAAAGG + Intergenic
972970489 4:44568949-44568971 TTTCTTAGGAAGAAGGAGAAAGG - Intergenic
974160642 4:58133658-58133680 CTTATTTTGAAGATGGAGAAAGG + Intergenic
974365089 4:60936174-60936196 TTTTTTTTAAAGATTGAGAATGG + Intergenic
974409386 4:61519783-61519805 TGTTTTATGAAGGTGGAGGAGGG - Intronic
974474352 4:62361012-62361034 TTTTGTATCAATATGGCCAAAGG - Intergenic
975231410 4:71938353-71938375 TTTTTTATTTATAGGTAGAAAGG - Intergenic
975355272 4:73395400-73395422 TTTTTTTTAAATTTGGAGACAGG + Intergenic
975356754 4:73415037-73415059 TTTTGTATGAATATGCAAGAAGG + Exonic
975780191 4:77831173-77831195 TTGTTTATGAAAATGGAGCCAGG + Intergenic
975916340 4:79330220-79330242 TTGTTTATGATTATAGACAATGG - Intergenic
976046811 4:80958559-80958581 TTTCTTAAGAAGAAGGAGAAAGG + Intronic
976467993 4:85393253-85393275 TTTTATAAGAATATAGGGAATGG + Intergenic
976628895 4:87217659-87217681 TTTTTTTGGAATATAGAGAAAGG + Intronic
977330101 4:95627093-95627115 TTTTTCATGAATATAGAGAAAGG + Intergenic
977936511 4:102811844-102811866 TTTTTTCTTTTTATGGAGAATGG - Intronic
978145683 4:105368648-105368670 TTGTTCAAGAATAAGGAGAAAGG + Intergenic
978181755 4:105806291-105806313 TCTTTTATTCATATGGAAAATGG + Intronic
978182790 4:105820934-105820956 TTTGTTAAGAATAAGGAGATAGG - Intronic
978745394 4:112188102-112188124 TATTCTTTGAAAATGGAGAATGG + Exonic
979089880 4:116469063-116469085 TTTTCTTTGAGTTTGGAGAATGG + Intergenic
979429041 4:120604434-120604456 TTATTTTTGTATATGGTGAAAGG - Intergenic
979436188 4:120694846-120694868 TGTCTTATAAAAATGGAGAAAGG - Exonic
979605441 4:122633765-122633787 ACTTATATGAATTTGGAGAAAGG + Intergenic
979851728 4:125579765-125579787 TTTTTGATGGAAATGTAGAATGG + Intergenic
980766765 4:137316528-137316550 TTTTTTATGAAAATGAATTAGGG + Intergenic
980891568 4:138820639-138820661 TTTTTTATGGCTATGTAGTAAGG + Intergenic
981076010 4:140593155-140593177 TGTTTTATCAATATTAAGAATGG + Intergenic
981155698 4:141432414-141432436 TTTCATATGGAAATGGAGAAGGG + Intergenic
982377274 4:154706888-154706910 TTTTTCATGAACAAGGAGACTGG - Intronic
982590345 4:157301274-157301296 TTTTTCATGTATGTGAAGAAAGG + Intronic
982700544 4:158656476-158656498 TCTTATATGATTATGGAGACTGG + Intergenic
983196617 4:164813586-164813608 TTTTTTTTTAATATAGAGATGGG - Intergenic
983445510 4:167845679-167845701 TTTTTGATGAGTTTGAAGAAAGG + Intergenic
983632516 4:169863659-169863681 TTTTTTTTTAATATAGAGATGGG + Intergenic
983845978 4:172518470-172518492 TTTTTTTAGAATTTAGAGAACGG + Intronic
986336012 5:6755984-6756006 AGTTTTAGGAATGTGGAGAAAGG + Exonic
986447035 5:7830677-7830699 ATTGTTTTGAATATGGAAAAAGG - Exonic
986455955 5:7918717-7918739 TTTTTCATGCATATGGATAATGG + Intergenic
986678926 5:10215854-10215876 TTTTTTATTTTTTTGGAGAAAGG - Intergenic
986828662 5:11550805-11550827 TTCTTGTTGAAAATGGAGAATGG + Intronic
986930434 5:12812772-12812794 TTTTCTAGGAATTTGGACAAAGG - Intergenic
987217809 5:15756454-15756476 TAGATTATGAAAATGGAGAAAGG - Intronic
987698278 5:21360482-21360504 TTTTTCATGTTTGTGGAGAATGG + Intergenic
987969259 5:24921039-24921061 TTTTTTCTGTATATACAGAAGGG - Intergenic
988179608 5:27772864-27772886 TTTTTTTTTTATATGGACAAAGG + Intergenic
988502823 5:31797951-31797973 TTTTCTATGTTTATGGAGAATGG + Intronic
988692916 5:33590648-33590670 TTTTTTATTTTTATAGAGAAAGG + Intronic
988754376 5:34231050-34231072 TTTTTCATGTTTGTGGAGAATGG - Intergenic
988774222 5:34462780-34462802 TTTTTTGTGAATGTGGAGTGGGG + Intergenic
988910659 5:35838418-35838440 TTTTTTGAGAATTTGGAGCAAGG + Intergenic
989461404 5:41703642-41703664 TTATTTTTGGATATGGTGAAAGG + Intergenic
989779881 5:45251343-45251365 TTTTCTATGAAAAGAGAGAATGG - Intergenic
989790945 5:45400826-45400848 GATTATATGAACATGGAGAAAGG - Intronic
989803416 5:45573664-45573686 TTTTTTAAGTATATAGTGAATGG - Intronic
989950054 5:50286515-50286537 TTTTCTTTTGATATGGAGAAGGG - Intergenic
990134225 5:52625897-52625919 TTTTTTGTGGCTATTGAGAATGG + Intergenic
990540868 5:56771313-56771335 TTTCTTATGAATAAAGATAAGGG + Intergenic
990771452 5:59251002-59251024 TTTTTTGTGTGTATGGTGAAAGG - Intronic
990866971 5:60390504-60390526 ATTTTAATTAATAAGGAGAATGG - Intronic
990995183 5:61726147-61726169 TGATTTATGAATGTGGAGGAAGG + Intronic
991742153 5:69691892-69691914 TTTTTCATGTTTGTGGAGAATGG - Intergenic
991755540 5:69863316-69863338 TTTTTCATGTTTGTGGAGAATGG + Intergenic
991793727 5:70271632-70271654 TTTTTCATGTTTGTGGAGAATGG - Intergenic
991821544 5:70567196-70567218 TTTTTCATGTTTGTGGAGAATGG - Intergenic
991834867 5:70738464-70738486 TTTTTCATGTTTGTGGAGAATGG + Intergenic
991886105 5:71271164-71271186 TTTTTCATGTTTGTGGAGAATGG - Intergenic
992445359 5:76828493-76828515 TTTTTTTTTAATATAGAGACAGG + Intronic
992922540 5:81541745-81541767 TATTTTTTGTATATGGTGAAAGG - Intronic
993125532 5:83830907-83830929 TTTTTTATTAATTAGTAGAAAGG + Intergenic
993438902 5:87930705-87930727 TTTTTTGTGAATATTGTAAATGG - Intergenic
993586099 5:89730323-89730345 TCTTCTATTAATATGCAGAATGG + Intergenic
993799617 5:92316672-92316694 ATTTTTGTGCAAATGGAGAAAGG + Intergenic
994089128 5:95793201-95793223 TTTTTTATTATTATGAAGAATGG + Exonic
994125051 5:96159548-96159570 GTTTGTATGAGTATGGGGAAGGG - Intergenic
994258888 5:97633604-97633626 ATTTTAATGAATTTGGAGCATGG - Intergenic
994874284 5:105395509-105395531 TTTATTATGAAAATTGATAAAGG - Intergenic
994896224 5:105706912-105706934 TTTTTTTTTAAGATGGAGGAAGG + Intergenic
994905009 5:105829340-105829362 TTTTTTTTTAAGTTGGAGAAAGG + Intergenic
995487678 5:112655750-112655772 TTTTTTTTTAATATAGAGATGGG - Intergenic
995575321 5:113524963-113524985 ATTTTTATTAATATTCAGAAAGG + Exonic
995639810 5:114242706-114242728 ATTTTTGTGAACATAGAGAAAGG + Intergenic
995788623 5:115859327-115859349 TTTTTTATCATTCTTGAGAAGGG + Intronic
996075246 5:119185227-119185249 TTTTTGATAAATAGGGGGAAAGG - Intronic
996229917 5:121049783-121049805 TATGTTATGAATATGGTGAAAGG - Intergenic
996249153 5:121305813-121305835 TTTTTTAGGGGTATAGAGAAAGG - Intergenic
996458632 5:123715130-123715152 TCTATTATGAATATGTTGAAAGG - Intergenic
996526085 5:124481256-124481278 TTTTTTATGAATATAACCAAGGG + Intergenic
996552864 5:124748030-124748052 TTTTTTAAGGAGATGGCGAATGG + Intronic
996696204 5:126398191-126398213 TTTTTTATTATTGTAGAGAAAGG + Intronic
996963068 5:129274535-129274557 ATTTATATGAATATGGGTAATGG - Intergenic
998541360 5:142984909-142984931 TTTTTTTTTAATAAGTAGAAGGG - Intronic
999876565 5:155813038-155813060 TTTTTTAAGAAAAGGAAGAAAGG + Intergenic
1000217168 5:159171377-159171399 ATGTTTCTAAATATGGAGAAAGG - Intronic
1000782613 5:165501886-165501908 TTCATTACTAATATGGAGAAGGG - Intergenic
1001086911 5:168707201-168707223 CTTTTTACGGATATGGAGACTGG - Intronic
1001530984 5:172461512-172461534 TGTTTTAAGAATAGAGAGAACGG - Intergenic
1001651967 5:173322284-173322306 TTTTTTTTAAATATTGACAATGG - Intronic
1002436820 5:179236617-179236639 TTTTTTATGTGTATGGAGACAGG - Intronic
1003194225 6:3900806-3900828 ATTTTTATAAATATTGAGAAGGG - Intergenic
1003217707 6:4129960-4129982 TTTTATAAGTATAGGGAGAAAGG - Intronic
1004180116 6:13373867-13373889 CTTTTAATGTATATGGAGGAAGG - Intronic
1004214601 6:13690035-13690057 TTTTTTATGAACATCGTAAAGGG - Intronic
1004383359 6:15151118-15151140 TTTTTTATTAAAATAGAGATGGG - Intergenic
1004412465 6:15393514-15393536 TTCTTTAGTAATATGGTGAAAGG - Intronic
1004431907 6:15552616-15552638 TTTTTCAAGAAAATAGAGAAAGG - Intronic
1004895360 6:20142744-20142766 TTTTTTAACAATATGCAGGATGG - Intronic
1005388401 6:25309057-25309079 TTTATTTTGAAAATGGAGACAGG + Intronic
1005552561 6:26937904-26937926 TTTTTCATGTTTGTGGAGAATGG - Intergenic
1005706576 6:28460719-28460741 TTATTTATGCACATGTAGAAAGG - Intergenic
1007659092 6:43471387-43471409 TATTTTAAGAATAAGGAGAAGGG + Intergenic
1007893095 6:45314761-45314783 TTTTTTCTAACTGTGGAGAATGG - Intronic
1008169558 6:48186109-48186131 TTATTTATAAATATGGTGACTGG + Intergenic
1008486479 6:52041597-52041619 TTTATTAAGACTATGGGGAAAGG - Intronic
1008771626 6:54985776-54985798 TTATTTTTGTATATGGTGAAAGG - Intergenic
1008850728 6:56017929-56017951 TTATTTACAAATATGGAGGAAGG + Intergenic
1008904452 6:56661018-56661040 ATTTTAATGAATACAGAGAATGG + Intronic
1008933652 6:56966405-56966427 TTTTTTATAAATATGAGGGAAGG + Intronic
1010236030 6:73575412-73575434 TTTTTTCTGTTTGTGGAGAATGG + Intergenic
1010316135 6:74452542-74452564 TTATTTATCAATAAGGAGACAGG - Intergenic
1010381812 6:75233943-75233965 TTTTTGATAAATATGGACAGAGG + Intergenic
1011106339 6:83785886-83785908 TGTTATATGATTATGAAGAATGG + Intergenic
1011109967 6:83827107-83827129 TCATTTCTGAGTATGGAGAATGG - Intergenic
1011418564 6:87148855-87148877 TTTTTTATAAAATTGGTGAAAGG + Intergenic
1011591518 6:88974729-88974751 TTTTTTTTGAATTTTGAGACAGG - Intergenic
1012079671 6:94740004-94740026 TTTTTTATTAATCTAGATAATGG - Intergenic
1012095157 6:94948349-94948371 TCTTTTATTTATATGGTGAAAGG + Intergenic
1012112031 6:95247589-95247611 TTTTTCAATAATAGGGAGAAAGG - Intergenic
1012126805 6:95439682-95439704 TTTTTTTTTAATAAGGAGAATGG - Intergenic
1012482310 6:99680671-99680693 TTTTTTAGGTTTGTGGAGAAAGG + Intergenic
1012604096 6:101135280-101135302 TTTTTTATGAATGTGGTAGACGG - Intergenic
1013358461 6:109369825-109369847 TTTTTTAAAAATATGGAGGGAGG + Intronic
1013874930 6:114813462-114813484 TTGTTTATAAATATAGACAAAGG - Intergenic
1014627377 6:123744146-123744168 TTATTTATGTATTTGGAGACTGG + Intergenic
1014995388 6:128136495-128136517 TTTTTTATGAAGTTGTATAAGGG + Intronic
1015476410 6:133663479-133663501 TTATTTTTGTATATGGTGAAAGG - Intergenic
1015486849 6:133781427-133781449 TTTTTTCTTAATATGGCTAAAGG + Intergenic
1015697232 6:135994163-135994185 TGTTTTATGTATATTAAGAAGGG + Intronic
1015938033 6:138421987-138422009 TTTTTTTTGAATAATGAGATAGG - Exonic
1015982509 6:138853411-138853433 TATTTTATAAATATCTAGAAAGG - Intronic
1016014512 6:139170169-139170191 TTTTTTATGAAGATGAATATGGG + Intronic
1016047794 6:139498108-139498130 TTTTTTAAGAAGCTGGGGAATGG - Intergenic
1016150715 6:140738399-140738421 TTTGGCATGAATATGGTGAAAGG - Intergenic
1017303899 6:152893986-152894008 TTTTTTATGACTCTAGAGAAAGG + Intergenic
1019215719 6:170442373-170442395 TTTTTTATGACATTGGAGTAGGG + Intergenic
1019415598 7:925347-925369 TTTTTTTTAAATATAGAGACGGG - Intronic
1019883080 7:3880564-3880586 TTTTTTAAGAACATGCAGACAGG + Intronic
1020392745 7:7675944-7675966 GATTTTATGAAAATGGTGAAGGG - Intronic
1020547462 7:9550926-9550948 TTTTATATAAACATGGAGTACGG - Intergenic
1021010689 7:15461318-15461340 TTTTTTTTGAAAATAGAAAAGGG - Intronic
1021164341 7:17317126-17317148 TTTTTTTTGAATATGCATAAGGG + Intronic
1021377422 7:19925014-19925036 TTTTATATTAAAAAGGAGAATGG + Intergenic
1021413197 7:20351885-20351907 TTTTTTTTTAAGTTGGAGAAAGG + Intronic
1021468743 7:20977320-20977342 TTTTTTTTTAATCTGTAGAAGGG + Intergenic
1021735122 7:23635486-23635508 TGTATTGTGAATATAGAGAAAGG + Intronic
1022128600 7:27381235-27381257 TCTTCTATGAAAATTGAGAATGG + Intergenic
1022523341 7:31021868-31021890 TTTTCTGTGAATAAGGAGACAGG - Intergenic
1022676687 7:32507063-32507085 TTATTTATTAATATTGTGAAAGG - Intronic
1023175128 7:37428825-37428847 ATTTTGATGAAAATAGAGAAAGG - Intronic
1023580080 7:41672360-41672382 TTTATTGGAAATATGGAGAAAGG - Intergenic
1023599970 7:41872749-41872771 TTTTTTTTCAACGTGGAGAATGG - Intergenic
1024213930 7:47230429-47230451 TTTTTTAAGAAAATAGAGATCGG - Intergenic
1024421599 7:49173600-49173622 TTTTTTTTGAATTTAGAGATGGG - Intergenic
1024662120 7:51507013-51507035 TTTTGTATAAATGTGGAGATGGG + Intergenic
1024994024 7:55257454-55257476 TATCCAATGAATATGGAGAATGG + Intergenic
1025093331 7:56080565-56080587 TTTTGGAGGCATATGGAGAAGGG - Exonic
1025526722 7:61822660-61822682 ATTTTTATCTATTTGGAGAATGG + Intergenic
1025720405 7:64006076-64006098 TATTTTCTAAATATGTAGAAAGG + Intergenic
1026877000 7:73885409-73885431 TTTTTTATAAAAATAGAGACAGG + Intergenic
1027457504 7:78411835-78411857 ATTTAAATGAATAAGGAGAAAGG + Intronic
1027518633 7:79174662-79174684 TTTTTTATTAATATAGAGATGGG - Intronic
1027848125 7:83411872-83411894 TTTTCTATGTCTATGGAGATGGG + Intronic
1027851144 7:83453407-83453429 TTTTTTTTCAGTAGGGAGAATGG - Intronic
1028279863 7:88909963-88909985 TTTGTTGTGAATATAGACAATGG + Intronic
1028811603 7:95094296-95094318 TTTCTAATGGAGATGGAGAAGGG - Intronic
1030969363 7:116035160-116035182 TTTTTTATGATTATAAATAAAGG - Intronic
1031371088 7:120967511-120967533 TTTTTTATTTATATTTAGAAAGG + Exonic
1031733329 7:125325367-125325389 TTTGTGATGAATATATAGAAAGG + Intergenic
1032166139 7:129546599-129546621 TTTTGTATGAGTATAGAGAAAGG - Intergenic
1033033992 7:137853904-137853926 TATTCTAGGAAGATGGAGAAAGG - Intergenic
1033188791 7:139256895-139256917 TTTTTCAATTATATGGAGAATGG - Intronic
1033204207 7:139403372-139403394 TGTTTTATGAAAATGCAGAATGG + Intronic
1033764000 7:144467507-144467529 TTTTTTATATATATAGAGATGGG - Intronic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034388901 7:150766762-150766784 TTTGTTATCTATATGTAGAATGG - Intergenic
1034530943 7:151696181-151696203 ATTTTAACGAATAAGGAGAAGGG - Intronic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1035875931 8:3189672-3189694 TACTTCATAAATATGGAGAAGGG + Intronic
1035879615 8:3230866-3230888 TTCTTTATATATATGCAGAAAGG - Intronic
1035986969 8:4444923-4444945 TATTTTATGTAAATGAAGAAGGG - Intronic
1036580157 8:10066396-10066418 GATTTTATGAATACAGAGAAAGG - Intronic
1036986689 8:13539823-13539845 TTATTTCTAAATATTGAGAAGGG + Intergenic
1037101732 8:15055217-15055239 TGTTTTATGGATATGGAAACTGG - Intronic
1037461463 8:19114869-19114891 TTTTTTTTTAATATAGAGACAGG + Intergenic
1037615518 8:20515556-20515578 CTTTTTACGAATATGGAAACAGG + Intergenic
1039773028 8:40707488-40707510 CTTTTTATGAATAGGCAGATAGG - Intronic
1039904513 8:41776252-41776274 TTTTTTCTGAATAGAGAGAATGG - Intronic
1040082430 8:43301189-43301211 TTTTTAATTAGTATGGAGAGAGG + Intergenic
1040276113 8:46014623-46014645 TCTTTTATGATTGTGGATAAGGG - Intergenic
1040525544 8:48220732-48220754 TTTTTTAAAAAAATGGAGATGGG - Intergenic
1040734714 8:50491397-50491419 TTTTTGATGGATATGGATAAAGG + Intronic
1040909049 8:52499800-52499822 TTTTTTATGAATATCTTTAAAGG + Intergenic
1041173826 8:55172417-55172439 TTTTTTACCAATTTGGAGCAGGG - Intronic
1041765962 8:61418530-61418552 GTTTGTATGAGTATGGAGAAAGG - Intronic
1041820636 8:62028575-62028597 TTATTTATGAAAGAGGAGAAAGG + Intergenic
1041920459 8:63177249-63177271 ATTTTTAGGATTATGGAGAGTGG + Intronic
1042249114 8:66738345-66738367 TTTTAAAGCAATATGGAGAATGG - Intronic
1042321695 8:67482315-67482337 GTGTTTATGAGTATGGAAAATGG + Intronic
1042379644 8:68098067-68098089 TATTTTATTAATTTGGATAAAGG - Intronic
1042669067 8:71240735-71240757 TATTTTATGAAGATGGATACAGG - Intronic
1043084243 8:75808562-75808584 TTATTGAAAAATATGGAGAATGG + Intergenic
1043221285 8:77668465-77668487 TTTTATATGAATATGATGTATGG + Intergenic
1043559854 8:81479905-81479927 TTTTTTGTTAATTTGGAGACAGG + Intronic
1043661962 8:82754687-82754709 TATTTTAAGAATATGAAAAAGGG + Intergenic
1044026789 8:87183066-87183088 TGATTTTTGAATATGGTGAAAGG + Intronic
1044266108 8:90183527-90183549 TTTTTTTTGCATGTGGAAAATGG - Intergenic
1044496651 8:92895240-92895262 TTTCTTATGATTGTGGAGACTGG - Intronic
1044528751 8:93283416-93283438 TATCATATGAATATGAAGAAGGG + Intergenic
1044772937 8:95656392-95656414 ATTTTTTTTAATATGGTGAAAGG + Intergenic
1044814607 8:96098649-96098671 TTTTTTATAAGTATGCAGAATGG + Intergenic
1044975352 8:97659277-97659299 TTATTTATGCATATGGGGGAAGG - Intronic
1044975590 8:97662201-97662223 TTTTTTTTTAATATAGAGACAGG + Intronic
1044976148 8:97667818-97667840 TTTTTTTTTAATATAGAGACAGG - Intronic
1045199310 8:99963198-99963220 ATTTTTATGAAAATGGACTAAGG - Intronic
1046083604 8:109403410-109403432 TTTGTTATTCATATGGATAAAGG + Intronic
1046249756 8:111613972-111613994 TTTATTGTAAATATAGAGAATGG + Intergenic
1046348667 8:112974025-112974047 TTTGTAAAGAATATGGGGAAAGG + Intronic
1046980870 8:120335311-120335333 TTTGTTATGAATCAGCAGAAAGG + Intronic
1047228118 8:122973670-122973692 TGTTTTATTAATTTGGGGAAAGG + Exonic
1047273206 8:123382605-123382627 TTCTTTTTTAAAATGGAGAAGGG - Intronic
1048177872 8:132169420-132169442 TTTTCTATGGTTATGGAAAAGGG - Intronic
1048183138 8:132214566-132214588 GTATTTGTGCATATGGAGAAGGG - Intronic
1048403458 8:134094725-134094747 TCTTTCATGAAGATGAAGAAGGG - Intergenic
1048621230 8:136134851-136134873 CTTTTTCTCAAAATGGAGAATGG + Intergenic
1050368227 9:4893068-4893090 TTTTTTATGAAATTTTAGAACGG + Intergenic
1050964388 9:11779869-11779891 TTTTTAATGAATATTGTCAATGG - Intergenic
1052100704 9:24442678-24442700 ATTTTTTTTAATATGGTGAAAGG - Intergenic
1052912280 9:33894259-33894281 TTTTTTTTAAATATAGAGATGGG - Intronic
1053089127 9:35257287-35257309 TTTTTTATAAATATAAAAAATGG - Intronic
1055192980 9:73549819-73549841 GTTTTTGTGACTATGCAGAAAGG - Intergenic
1055199357 9:73640365-73640387 TGTTGGATGAAAATGGAGAAGGG + Intergenic
1055344678 9:75322865-75322887 TTTTTTTTGAATAAGGTGTAAGG + Intergenic
1055345425 9:75331388-75331410 TTTTTTGTGTGTATGGTGAAAGG - Intergenic
1055462176 9:76529416-76529438 TTTTTTTTAAATATAGAGACAGG - Intergenic
1055761542 9:79614153-79614175 TGCTTTATGGAGATGGAGAATGG + Intronic
1056315913 9:85389526-85389548 TTTTGCATGATTCTGGAGAACGG + Intergenic
1056400433 9:86222518-86222540 TTCTGAATGAGTATGGAGAATGG - Intronic
1056526101 9:87444361-87444383 TTTTTCATGCACATGGAGGAGGG - Intergenic
1056556089 9:87689101-87689123 TTTTTTTTTTATATGGTGAAAGG + Intronic
1056940405 9:90950896-90950918 TTTCTAATTAATATGGGGAAGGG - Intergenic
1057033075 9:91793395-91793417 CTTTTTATGAAGAAGGAGATAGG - Intronic
1058135792 9:101306254-101306276 TTTTTTGTAAATGTGGACAAAGG - Intronic
1058201453 9:102047114-102047136 TTATTTTTGCATATGGTGAAAGG + Intergenic
1058257051 9:102779582-102779604 TTTTTACTGAAACTGGAGAATGG - Intergenic
1058750326 9:108032996-108033018 GTTTTGATGAGGATGGAGAAGGG - Intergenic
1058750351 9:108033188-108033210 GTTTTGATGAGGATGGAGAAGGG - Intergenic
1058758942 9:108110709-108110731 TTTTTTTATAATGTGGAGAATGG - Intergenic
1058790194 9:108436630-108436652 TTTTTCATAAAAAAGGAGAAAGG + Intergenic
1058907428 9:109493228-109493250 TGTTTTTTAAATATAGAGAAAGG - Intronic
1059552016 9:115238494-115238516 GCTCTTATGCATATGGAGAAAGG + Intronic
1060868683 9:127021683-127021705 TTTCCCAAGAATATGGAGAAAGG + Intronic
1061198790 9:129124213-129124235 TTTTTTTTAAATATAGAGACAGG + Intronic
1061599625 9:131659135-131659157 CTTTTTATGCATTTGGAAAATGG - Intronic
1203438881 Un_GL000195v1:169726-169748 TTTTGCAGGAAAATGGAGAAAGG + Intergenic
1185616067 X:1422918-1422940 ATAATGATGAATATGGAGAAAGG - Intronic
1185732715 X:2474198-2474220 TTTTCTAAGAATGTGGACAAGGG + Intronic
1185961303 X:4548351-4548373 ATATTTATTAACATGGAGAAGGG - Intergenic
1186229015 X:7432648-7432670 TTTTCAATGACTATGGTGAACGG - Intergenic
1186416538 X:9388149-9388171 TTTAGTATGAATATGGATTAGGG - Intergenic
1186654597 X:11599050-11599072 TTATTTATGTATTTGGAGACAGG - Intronic
1186667058 X:11728016-11728038 TAATTTTTGTATATGGAGAAAGG + Intergenic
1187560353 X:20397211-20397233 TTTTTTTTAAAAGTGGAGAAGGG + Intergenic
1187804079 X:23099026-23099048 TTATTTTTGTATATGGTGAAAGG - Intergenic
1187997156 X:24939778-24939800 TTTTTTGTGACTATGGAGTGTGG + Intronic
1188026661 X:25217212-25217234 GTTTCTTTGAATATGGGGAAAGG - Intergenic
1188680490 X:32997579-32997601 ATTTTCATGAACATAGAGAATGG - Intronic
1189090231 X:38074420-38074442 TTTTTTATTATTATTGAGATGGG + Intronic
1189275377 X:39781486-39781508 TTTTTTTTTAATATAGAGATGGG + Intergenic
1190577208 X:51852145-51852167 TTATGTCTGAAGATGGAGAAAGG - Intronic
1190821390 X:53976619-53976641 TTTTTTATTTTTATGGAGATGGG - Intronic
1191007406 X:55724330-55724352 TTTTTTATGGATGAGGAAAAAGG - Intronic
1191147351 X:57181473-57181495 TTTTTTATGGAAATTGTGAATGG - Intergenic
1191210470 X:57879448-57879470 TTTTTTTTGTATATGGTGAAAGG - Intergenic
1191261575 X:58327833-58327855 TTTTTTTTGAATGAGCAGAATGG + Intergenic
1191581599 X:62768233-62768255 TTTTTTATGATTAAGCAGATTGG - Intergenic
1191708405 X:64118663-64118685 TTTTTTATGTCTATTGTGAATGG + Intergenic
1191869509 X:65733964-65733986 TTTTTTTTTATTGTGGAGAAAGG + Intronic
1193264396 X:79451643-79451665 TTTCTTATAAATAAGGAAAAGGG - Intergenic
1194012478 X:88579816-88579838 TTAATTTTGTATATGGAGAAAGG - Intergenic
1194541792 X:95182175-95182197 TTTTTTATGAATAAAGAGGCTGG + Intergenic
1194994893 X:100581109-100581131 CTTTTTATGTATATATAGAAGGG - Intergenic
1195276838 X:103289443-103289465 TATTTTTTGTATATGGTGAAAGG + Intergenic
1195597476 X:106709054-106709076 TATTTTATTATTTTGGAGAATGG - Intronic
1196089823 X:111727721-111727743 CTTTTTATGAAGTTGAAGAAGGG + Exonic
1196143570 X:112292330-112292352 TTTTTCATTTATAAGGAGAAAGG - Intergenic
1196566671 X:117214162-117214184 TTTTTTGTGACTATGGTAAATGG - Intergenic
1196642598 X:118080105-118080127 TTATTTTTGTATATGGTGAAAGG - Intronic
1196850522 X:119933688-119933710 TTTTTTTTAAATATAGAGACAGG + Intronic
1197387511 X:125819453-125819475 TTATTTTTGTATATGGTGAAAGG + Intergenic
1197403002 X:126015726-126015748 TTTTTTATTAATCTGGCTAAAGG + Intergenic
1197876972 X:131118716-131118738 TTCTTTATGAAAATGCAAAATGG - Intergenic
1198326665 X:135580576-135580598 GTTTTCATGAAGATGGAGGAAGG - Intronic
1198728845 X:139705538-139705560 TAATTTTTGCATATGGAGAAAGG - Intronic
1198969017 X:142259400-142259422 TTTTTTAGGAAAATGAAGACAGG - Intergenic
1199381069 X:147173398-147173420 TTTATTATTATTATTGAGAAGGG + Intergenic
1199698178 X:150358430-150358452 TTTTTTATATATATAGAGATGGG + Intergenic
1199915984 X:152341513-152341535 GTTGTTATGGATATGGTGAAAGG - Intronic
1199932378 X:152536799-152536821 TTTCTTATGAATAGTGACAAAGG + Intergenic
1200361122 X:155607800-155607822 TTTTTTATGTCTATTGTGAATGG - Intronic
1201607683 Y:15805144-15805166 TTGTTACTGAATATGGAGATGGG - Intergenic
1201750963 Y:17431665-17431687 ATATTTATTAACATGGAGAAGGG - Intergenic
1202274475 Y:23101196-23101218 CTTTTTACGTATATTGAGAATGG - Intergenic
1202291552 Y:23319490-23319512 CTTTTTACGTATATTGAGAATGG + Intergenic
1202427468 Y:24734931-24734953 CTTTTTACGTATATTGAGAATGG - Intergenic
1202443323 Y:24935163-24935185 CTTTTTACGTATATTGAGAATGG + Intergenic