ID: 1147522544

View in Genome Browser
Species Human (GRCh38)
Location 17:41188322-41188344
Sequence TATGCTGGACCAGCAAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147522538_1147522544 18 Left 1147522538 17:41188281-41188303 CCAGATCATTTTATGGGATGAAC No data
Right 1147522544 17:41188322-41188344 TATGCTGGACCAGCAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147522544 Original CRISPR TATGCTGGACCAGCAAACAG AGG Intergenic
No off target data available for this crispr