ID: 1147528541

View in Genome Browser
Species Human (GRCh38)
Location 17:41251020-41251042
Sequence CACGCAGCTGTTTCTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147528541_1147528544 -9 Left 1147528541 17:41251020-41251042 CCTCAGTGAGAAACAGCTGCGTG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1147528544 17:41251034-41251056 AGCTGCGTGATATGGCAGCAGGG 0: 1
1: 1
2: 1
3: 7
4: 77
1147528541_1147528545 5 Left 1147528541 17:41251020-41251042 CCTCAGTGAGAAACAGCTGCGTG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1147528545 17:41251048-41251070 GCAGCAGGGACTGCATTTAATGG 0: 2
1: 1
2: 0
3: 13
4: 147
1147528541_1147528543 -10 Left 1147528541 17:41251020-41251042 CCTCAGTGAGAAACAGCTGCGTG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1147528543 17:41251033-41251055 CAGCTGCGTGATATGGCAGCAGG 0: 1
1: 1
2: 1
3: 9
4: 98
1147528541_1147528546 21 Left 1147528541 17:41251020-41251042 CCTCAGTGAGAAACAGCTGCGTG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1147528546 17:41251064-41251086 TTAATGGCTGCCCTGAATGCAGG 0: 2
1: 1
2: 1
3: 5
4: 109
1147528541_1147528547 22 Left 1147528541 17:41251020-41251042 CCTCAGTGAGAAACAGCTGCGTG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1147528547 17:41251065-41251087 TAATGGCTGCCCTGAATGCAGGG 0: 2
1: 1
2: 1
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147528541 Original CRISPR CACGCAGCTGTTTCTCACTG AGG (reversed) Intronic
902550298 1:17215181-17215203 CACTCATCTGTTACTCACAGGGG + Intronic
906110302 1:43318057-43318079 CACACACCTGCTTCTCACTCAGG - Exonic
908386441 1:63646730-63646752 CAAGTAGCAGTTTCTCATTGTGG + Intronic
910813796 1:91266409-91266431 CACCCAGCTGGTATTCACTGTGG + Intronic
910938449 1:92506666-92506688 CACTGAACTGTTTCTCACAGAGG + Intergenic
911473927 1:98352939-98352961 CAGTCAGCTGTTGCACACTGCGG - Intergenic
915302597 1:154959845-154959867 CCCTCAACTGTTTCTCACTAGGG - Exonic
916783804 1:168067400-168067422 CAAACAGCTGTTCCTCTCTGTGG - Intronic
917568815 1:176241615-176241637 CACCCTGCTGCTTCTCACTTGGG - Intergenic
923105937 1:230853906-230853928 CAGGCACCTGTTTCCCACTCTGG + Intronic
924661127 1:246018190-246018212 TACACAGCTCTTTCTCTCTGTGG + Intronic
1064569076 10:16673704-16673726 CACACAGATGCTTCTCAATGGGG + Intronic
1064986687 10:21217362-21217384 CAAGGAGCTGCTTCTCACAGGGG + Intergenic
1065978145 10:30862175-30862197 GAGTCAGCTGTTTCTCAATGGGG + Intronic
1068744332 10:60513013-60513035 AACACAGCTGTGTCTCAATGAGG + Intronic
1069598972 10:69691064-69691086 CAGGGAGCTTTTACTCACTGTGG - Exonic
1070341237 10:75500114-75500136 CACTGAGCTGCTTCTGACTGAGG + Intronic
1070841444 10:79490656-79490678 CACGCAGCTGTTCCTGAGTTGGG - Intergenic
1072158112 10:92742362-92742384 CATGCTGCTGCTTCTCACTCTGG - Intergenic
1073892070 10:108113495-108113517 AACCCCTCTGTTTCTCACTGTGG + Intergenic
1073922460 10:108474822-108474844 CACGAAGCAGCTTCTCAATGTGG + Intergenic
1081192309 11:40119094-40119116 AATGCAACTATTTCTCACTGGGG - Intronic
1083796726 11:65021272-65021294 AACCCTGCTCTTTCTCACTGTGG - Intronic
1087906507 11:103703819-103703841 CACACTGCTGCTTCTCACTGAGG - Intergenic
1088396805 11:109378136-109378158 CTCTCAGCTGTTTCTCTCTTTGG - Intergenic
1088868071 11:113867961-113867983 CATGCAGCTGGTACTTACTGAGG + Intronic
1091073667 11:132593218-132593240 CACCAAGCTGTTTCCCTCTGTGG - Intronic
1091230105 11:133982647-133982669 CAGGGAGAGGTTTCTCACTGAGG + Intergenic
1092268476 12:7002053-7002075 AGCACAGCTGTTTCTCACTTGGG + Intronic
1097825971 12:64174958-64174980 CAATCACCTGTTCCTCACTGAGG - Intergenic
1097906196 12:64921944-64921966 CAAGAAGCTGCTTCTCCCTGGGG + Intergenic
1099985772 12:89661834-89661856 TACATAGCTGTTTCTCACTGTGG + Intronic
1101971464 12:109316366-109316388 CACGCTGCTTTTTGTTACTGGGG - Intergenic
1103251009 12:119500056-119500078 CATTAAGCTGTTTCTCACTCAGG + Exonic
1104058650 12:125249612-125249634 AACGCAGCTGTCTCTGACAGGGG + Intronic
1104250515 12:127088960-127088982 CAGGAATCTGTTTCTCCCTGGGG + Intergenic
1104795458 12:131514046-131514068 CACACAGGTGTGTCTCTCTGGGG + Intergenic
1104932638 12:132347872-132347894 CACGCAGCTGCTTCATTCTGAGG + Intergenic
1109058619 13:57583169-57583191 CTCTCAGCTTTTTCTCTCTGAGG + Intergenic
1110027001 13:70552914-70552936 CAGGAAGATGTTTCTCCCTGGGG + Intergenic
1110260071 13:73474969-73474991 CACACTGCTGTTTCTGACTATGG + Intergenic
1113711934 13:112471136-112471158 CAGGGAGCTGTTACTCATTGTGG + Intergenic
1120053224 14:79892581-79892603 CACTCTGCAGTGTCTCACTGTGG + Intergenic
1121277200 14:92676539-92676561 CACGGAGATGCTTCTCAATGTGG + Exonic
1122816676 14:104317359-104317381 CATGGAGCTGTTGCTCAGTGAGG + Intergenic
1122997969 14:105275901-105275923 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122997980 14:105275954-105275976 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122997993 14:105276007-105276029 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998004 14:105276060-105276082 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998079 14:105276378-105276400 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998144 14:105276643-105276665 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998167 14:105276749-105276771 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998218 14:105276961-105276983 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998271 14:105277173-105277195 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998284 14:105277226-105277248 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998309 14:105277332-105277354 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998334 14:105277438-105277460 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998347 14:105277491-105277513 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998358 14:105277544-105277566 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1202929375 14_KI270725v1_random:25265-25287 CACGCTGCTGTCTGTCTCTGTGG - Intergenic
1123422918 15:20145957-20145979 CACGCTGCTGTCTGTCTCTGTGG + Intergenic
1123532144 15:21152497-21152519 CACGCTGCTGTCTGTCTCTGTGG + Intergenic
1126909348 15:53401676-53401698 CACCCAGCTTTCTCTCAGTGAGG + Intergenic
1128258097 15:66212883-66212905 CCTGCAGCTGTTTCTCCCTTTGG - Intronic
1129799027 15:78399647-78399669 TTTGCAGCTGTTTCTCACTGGGG - Intergenic
1131875506 15:96802092-96802114 CTCGGAGCTGTCTCTCACTTGGG - Intergenic
1133615357 16:7471233-7471255 CACTTAACTGTTCCTCACTGAGG + Intronic
1138163834 16:54781158-54781180 AACTCTCCTGTTTCTCACTGTGG + Intergenic
1138244987 16:55460720-55460742 CACTCAGCTCTTTCTCCCTGCGG - Intronic
1138374694 16:56554724-56554746 CACTCAGCTGGGTCGCACTGGGG + Intergenic
1138913275 16:61429365-61429387 CACCCAGCACTTTCTCACTGTGG + Intergenic
1140986430 16:80162079-80162101 CACAGAGGTGTTTCTCATTGTGG - Intergenic
1141087906 16:81109782-81109804 CATGCATGTGTTTCTCTCTGTGG + Intergenic
1143371958 17:6445839-6445861 CACTCAGCTGTGTATCCCTGAGG + Intronic
1147526392 17:41228020-41228042 CATGCAGCTGTTGCTCACTGAGG - Intronic
1147526920 17:41233825-41233847 CATGCAGCCTTTGCTCACTGAGG - Intronic
1147527424 17:41239373-41239395 CATGCAGCTGTTGCTCACTGAGG - Intronic
1147528541 17:41251020-41251042 CACGCAGCTGTTTCTCACTGAGG - Intronic
1147530006 17:41267006-41267028 CATGTAGCTATTACTCACTGAGG - Intergenic
1148123728 17:45226328-45226350 CACAGAGCTCTTACTCACTGGGG - Intronic
1151852075 17:76696895-76696917 TACGCAGCTGATTCTTCCTGAGG + Intronic
1152355823 17:79806685-79806707 CACCCCGCTGTCCCTCACTGGGG - Intergenic
1152471776 17:80493518-80493540 CACGCAGCCGCCTCACACTGTGG - Intergenic
1152527289 17:80895635-80895657 CACGCAGCAGCTTCACTCTGAGG - Intronic
1155088980 18:22487890-22487912 CAAGAAGTTGTTACTCACTGGGG - Intergenic
1155417606 18:25616783-25616805 CACTCAGCTGACTCTCTCTGCGG - Intergenic
1156018300 18:32570831-32570853 CAAGAAGCTGCTTCTCTCTGGGG - Intergenic
1158912050 18:62074117-62074139 CAAGCTTCTGTTTCTCCCTGTGG - Intronic
1160149696 18:76389773-76389795 CAAGCAGCTATTTCACTCTGAGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1163313359 19:16527063-16527085 CAGGCTGCTGTTTCTCAGTGTGG + Intronic
1163640843 19:18461170-18461192 CAGGCAGCTGATTCACACTGAGG + Intronic
1164712295 19:30365751-30365773 CAAGCAGGTGGTTCTCACTCTGG - Intronic
1165289849 19:34874290-34874312 CACTGGGCTGGTTCTCACTGAGG + Intergenic
1165435712 19:35793580-35793602 CACCCAGCTGTGACTCAGTGTGG + Intergenic
1165657276 19:37544934-37544956 CATTTAGCTGTTTCTCCCTGGGG - Intronic
1165890933 19:39111873-39111895 CAGCCAGCTCTTTCTCACTGCGG + Intergenic
1167166646 19:47803503-47803525 CCTGCAGCTGTTGCTCCCTGAGG + Exonic
1167175191 19:47860261-47860283 CCTGCAGCTGTTGCTCCCTGAGG - Intergenic
1168112821 19:54203875-54203897 CAAGGACCTGTTTCCCACTGAGG + Intronic
927795314 2:26043029-26043051 CACCCTATTGTTTCTCACTGTGG - Intronic
928023552 2:27722095-27722117 TAAGAGGCTGTTTCTCACTGTGG - Intergenic
930754428 2:54960496-54960518 CACCCAGCTGGTTCTTCCTGGGG - Intronic
935655854 2:105422149-105422171 CAAACAGCTGTTTCTTACTATGG - Intronic
936241257 2:110790393-110790415 CCCTCAGCTGTCTCACACTGTGG + Intronic
936244436 2:110814275-110814297 CTCACAGCTGTGTGTCACTGTGG + Intronic
936894549 2:117412754-117412776 CACAAATCTTTTTCTCACTGGGG + Intergenic
940117581 2:150225870-150225892 CAAGAAGCTGCTTCTCCCTGGGG + Intergenic
942214707 2:173707242-173707264 CACGCGGCTGTCTCTTTCTGAGG - Intergenic
945775628 2:214103154-214103176 CAAGAAGCTGCTTCTCCCTGGGG + Intronic
947782825 2:232784983-232785005 CAGGAAGCTGTTACTCATTGTGG - Intronic
948478696 2:238237502-238237524 AAAGCAGCAGCTTCTCACTGTGG - Intergenic
948908152 2:240989610-240989632 CTCACTGCTGTCTCTCACTGAGG - Intronic
1169277424 20:4243288-4243310 CAGGCAGCAGGCTCTCACTGCGG + Intronic
1170911444 20:20574149-20574171 CATGCAGCAGTATCTCACTGAGG + Intronic
1170935521 20:20805858-20805880 CACCCACTTGTCTCTCACTGAGG - Intergenic
1172522439 20:35576715-35576737 CACCCAGATATTTCTGACTGGGG - Intergenic
1173337449 20:42124365-42124387 CATGCATCTGTTACTTACTGGGG + Intronic
1175964459 20:62653522-62653544 CCCGGGGCTGGTTCTCACTGAGG + Intronic
1182247416 22:28970307-28970329 CACGTAGCAGTATCTCATTGTGG - Intronic
1183102867 22:35594469-35594491 CAGGCTGCAGTTTCTCACTGAGG - Intergenic
1184391692 22:44206856-44206878 CACCCACCTGCTTCTCACTCGGG + Exonic
949821274 3:8118319-8118341 CAGGCAGCAGTTTGTCATTGAGG - Intergenic
950574852 3:13826076-13826098 CATGCACCTGTTTCACAGTGAGG + Intronic
952454281 3:33458110-33458132 CAGGAAGCTGTTTCTTGCTGGGG + Intergenic
952928406 3:38340007-38340029 CACCCAGGTGTCACTCACTGGGG + Intergenic
953210695 3:40872526-40872548 CACGCAGCTTTTTCTTTCTCAGG + Intergenic
954746679 3:52791438-52791460 CACTCAGCAGGTGCTCACTGCGG - Intronic
961825342 3:129596420-129596442 CATGAAGCTGTTTCTCATTCCGG + Intronic
963412481 3:144948075-144948097 CAGGAAGCTGTTTTTCCCTGGGG + Intergenic
971621812 4:28863895-28863917 CAGGCAGTTGCTTCTCACTGGGG + Intergenic
971826575 4:31631050-31631072 CACTCAGCTGTTACTCCATGTGG - Intergenic
973915114 4:55625904-55625926 AACCCAGCTGTCTGTCACTGGGG - Intronic
976950972 4:90829981-90830003 CAAGAAGCTGCTTCTCCCTGAGG + Intronic
977985675 4:103380015-103380037 CAAGCAGTAGTTTCTCCCTGTGG - Intergenic
978343825 4:107744764-107744786 TATGCAACAGTTTCTCACTGTGG + Intergenic
985504141 5:269071-269093 CACTGAGCTGTTTCTTGCTGAGG + Intergenic
987416250 5:17664480-17664502 AACTCAGCTGTTTTTCATTGTGG + Intergenic
992011932 5:72536968-72536990 CATATAGCTGTATCTCACTGTGG - Intergenic
997260584 5:132463004-132463026 CAAGCAGCTGTTCCTCTCTTGGG - Exonic
997264797 5:132489267-132489289 CAAGCAGGTGTTTCTCCCAGTGG - Intronic
998929898 5:147169991-147170013 CACGCAGCTGTCTCTGTCTCAGG + Intergenic
1004696535 6:18039078-18039100 CATGCAGTAGTTTCTCACTGGGG - Intergenic
1011334707 6:86247400-86247422 CACCCAGGTGTTTATCACTGTGG + Intergenic
1012938801 6:105396084-105396106 TACTCAGGTGTTTCTCACTTTGG + Intronic
1013075147 6:106764555-106764577 CACCCAGCTGTGTCTCTCTCTGG - Intergenic
1019161945 6:170074951-170074973 CACACAGCAGTTTCTCAGTGTGG - Intergenic
1020389502 7:7643202-7643224 CAGGAAGCTGTTTCTCCCTCGGG - Intronic
1021329233 7:19314368-19314390 CATAGAGTTGTTTCTCACTGTGG - Intergenic
1022657060 7:32329269-32329291 TAAGCAGCTCTTTCACACTGAGG + Intergenic
1024011550 7:45271270-45271292 CACGCAGCGGTTCAGCACTGAGG - Intergenic
1026824471 7:73572847-73572869 CACGCTGCTGTATCTCCCTGTGG - Exonic
1026983295 7:74538850-74538872 CAGGCCGCTGTTTCTCTCTGTGG + Intronic
1028270476 7:88782200-88782222 CACACATCTGTATCTCACTCAGG + Intronic
1029106402 7:98179850-98179872 CACGCAGCTGGTCCTCAATGTGG - Intronic
1031661984 7:124436743-124436765 CAAGCAGCTGTTTGTCAGTCAGG - Intergenic
1032750229 7:134832207-134832229 CAGAAAGCTGTTTCTCTCTGGGG + Intronic
1034502904 7:151462493-151462515 CACCCAGCACTTTCTCCCTGGGG + Intergenic
1035142559 7:156777324-156777346 CACTCAGCTGTGTCCTACTGAGG - Intronic
1036097712 8:5741889-5741911 CACGGGGAGGTTTCTCACTGTGG - Intergenic
1037328105 8:17715232-17715254 CATGCAGCTTTGTCTCAGTGGGG - Intronic
1037691775 8:21186719-21186741 CAAGCAGCTGGTTCTTACTAGGG + Intergenic
1038273899 8:26103108-26103130 CGCCCAGCTGTTTCCCACAGTGG - Intergenic
1039972082 8:42328601-42328623 CATGCTGCTCTTTTTCACTGTGG + Intronic
1045381935 8:101635945-101635967 GACACAGCTGTTTCTCACCCAGG + Intronic
1046799993 8:118415640-118415662 CATGCAGCTGACTCTTACTGAGG + Intronic
1050023381 9:1308206-1308228 CTGGCTGCTGCTTCTCACTGAGG + Intergenic
1050719242 9:8566474-8566496 CACTAAGCTGTTTCATACTGAGG - Intronic
1050907659 9:11026375-11026397 CAGGAAGCTGTTTCTCATGGTGG + Intergenic
1051098090 9:13489687-13489709 CACAAAGTTGATTCTCACTGCGG + Intergenic
1052320801 9:27165361-27165383 CATGCAGCTCTTGCTCTCTGTGG - Intronic
1052620138 9:30898256-30898278 CAGGAAGCTGCTTCTCTCTGGGG - Intergenic
1055772203 9:79729548-79729570 CGCCCAACAGTTTCTCACTGTGG + Intergenic
1056657653 9:88522446-88522468 CACGCAGCTGTGTGGCTCTGCGG + Intergenic
1060528394 9:124333367-124333389 CAGGGTGCTGTGTCTCACTGGGG - Intronic
1061990196 9:134154582-134154604 CACGCAGGTGTCTCTGGCTGGGG - Intronic
1203774869 EBV:67253-67275 CCAGGAGCTGTTTCGCACTGCGG + Intergenic
1203621424 Un_KI270749v1:132628-132650 CACGCTGCTGTCTGTCTCTGTGG - Intergenic
1186754936 X:12660765-12660787 CATCCAGATGGTTCTCACTGGGG + Intronic
1186795576 X:13044192-13044214 TACGCACCTGTTTCTGACAGGGG + Intronic
1187084478 X:16027864-16027886 CAAGAAGCTGCTTCTCCCTGGGG - Intergenic
1190157802 X:48007838-48007860 CACGCTGATGGTTGTCACTGTGG + Exonic
1190173574 X:48130723-48130745 CACGCTGATGGTTGTCACTGTGG + Exonic
1190365955 X:49695387-49695409 CACTCGGGTGTTTCTCACTCGGG + Intronic
1192586351 X:72321357-72321379 CACCAAACTGTTTCCCACTGCGG + Intergenic
1193507577 X:82362792-82362814 CAGGCAGCTGTCTCTGTCTGGGG + Intergenic
1196224759 X:113153014-113153036 TATGCAGCTGTATCTCATTGTGG - Intergenic
1196701547 X:118674738-118674760 CACGAAGCTGTTTTCCACAGTGG + Intronic
1197938058 X:131761047-131761069 CAAGAAGCTGCTTCTCCCTGGGG - Intergenic
1197939680 X:131776823-131776845 CAAGAAGCTGCTTCTCCCTGTGG - Intergenic