ID: 1147529967

View in Genome Browser
Species Human (GRCh38)
Location 17:41266310-41266332
Sequence CTTGGGAATCAGCTTGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 3, 2: 5, 3: 23, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147529961_1147529967 10 Left 1147529961 17:41266277-41266299 CCAATTTTTTTTATTTCTTTGCC 0: 1
1: 2
2: 32
3: 329
4: 3453
Right 1147529967 17:41266310-41266332 CTTGGGAATCAGCTTGAGGGAGG 0: 1
1: 3
2: 5
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147529967 Original CRISPR CTTGGGAATCAGCTTGAGGG AGG Exonic
901156780 1:7145537-7145559 CTTGGGAATGAGCTGGAGCTGGG + Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903209890 1:21812052-21812074 TTAGGGACTGAGCTTGAGGGAGG - Intergenic
903391153 1:22964442-22964464 CTTGGGGGTCGGGTTGAGGGGGG - Intronic
903778264 1:25806736-25806758 CTTGGGAATGACCTTGAGGCTGG + Intronic
904841064 1:33372260-33372282 CTTGGGAAGGACCTTGAGGCTGG - Intronic
905799013 1:40831499-40831521 TTTGGGAATCACGTGGAGGGTGG + Intronic
907328831 1:53658304-53658326 TCTGGGAAGCAGCTTGAGGAAGG + Intronic
909657442 1:78046568-78046590 TTTGGGAAGCGGGTTGAGGGAGG + Intronic
910876511 1:91883947-91883969 CTTAGGAAACAGCTTGGGGTTGG - Intronic
911531583 1:99049950-99049972 CTTGGGAGTCAGCATCAGGGAGG - Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916747660 1:167697129-167697151 CTTCGGAATCGCCTGGAGGGAGG - Exonic
918258421 1:182771280-182771302 CTTAGGAATCTGCTTTTGGGAGG + Intergenic
918276656 1:182959388-182959410 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
920872493 1:209805909-209805931 TCTGGGGACCAGCTTGAGGGAGG - Intronic
921178522 1:212613739-212613761 CTTGGGAACCAACTGCAGGGAGG + Intronic
921381931 1:214533133-214533155 CTTGGAGAACAGCCTGAGGGAGG + Intronic
921681623 1:218039818-218039840 CTTAGGAATCAGATTGAGGTGGG + Intergenic
921984436 1:221296167-221296189 CTAGGGAGCCAGGTTGAGGGAGG - Intergenic
1063856016 10:10254943-10254965 CTGGGGACCCAGCTTTAGGGAGG + Intergenic
1064000689 10:11661590-11661612 CTTGTCAATCAGAATGAGGGAGG - Intergenic
1064619789 10:17203184-17203206 CTTTGGAATCCGCTTGGTGGAGG + Intergenic
1064883706 10:20085744-20085766 CAAGAGAATCATCTTGAGGGAGG - Intronic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1067739267 10:48882153-48882175 CTTAGGACCCAGCTTGAGGGAGG + Intronic
1069346546 10:67476884-67476906 CCTGGAGATCTGCTTGAGGGTGG - Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1070904392 10:80059027-80059049 TTTTGGAAGCAGCTTGATGGGGG - Intergenic
1071447190 10:85759403-85759425 GGTGGGGATCAGCTTGAGTGGGG - Intronic
1071468743 10:85963578-85963600 CTTTGGAATCAGGTTGGGCGTGG - Intronic
1072318376 10:94225040-94225062 CTCAGGACTGAGCTTGAGGGTGG + Intronic
1073558851 10:104480266-104480288 TTTGGCAACCAGCTTAAGGGTGG + Intergenic
1074355935 10:112783076-112783098 CTTCAGAATCAACTTGAGAGAGG - Intronic
1074866249 10:117545861-117545883 CTTGGGAGCCAGCTTTGGGGAGG - Intronic
1075233924 10:120709602-120709624 CTGCGGGATCAGCTGGAGGGAGG + Intergenic
1076747202 10:132520288-132520310 CTTTGGCCTCAGCTAGAGGGAGG + Intergenic
1078073997 11:8140621-8140643 TTTAGGAATCAGGTTGATGGAGG - Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1080827517 11:35860557-35860579 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
1083423599 11:62570849-62570871 CTTGGAAAACAGCTAGAGGTGGG - Intronic
1085339580 11:75722459-75722481 CTTGGGATTCAGCTCAAGAGTGG - Intronic
1085407143 11:76270037-76270059 CTTTGGAAGCAGCTTGGGGAAGG - Intergenic
1085739087 11:79063827-79063849 CTTGGGAACGAGCCTCAGGGAGG + Intronic
1086392803 11:86382638-86382660 TTTGGGAATCATCCTGAGTGTGG + Intronic
1087713502 11:101582373-101582395 CTCGGGAAACCGCTTGCGGGTGG + Intronic
1090430831 11:126645003-126645025 CTTGGGATGAACCTTGAGGGAGG + Intronic
1091399911 12:175402-175424 CTTGGGCAGCAGCATGAGGCTGG + Exonic
1092074533 12:5662034-5662056 CCCTGTAATCAGCTTGAGGGTGG - Intronic
1092160225 12:6311754-6311776 CTTGGGAAAAAGCTGGAGGGAGG - Intronic
1092931330 12:13318534-13318556 TTAGGGAATGAGCTTGAGAGAGG + Intergenic
1096634930 12:52952127-52952149 CTTGGAGAACAGCCTGAGGGAGG + Exonic
1097662495 12:62446072-62446094 CCTGGAAATCTGCTTGAGTGTGG + Intergenic
1097950186 12:65419036-65419058 CTTGGAGAACAGCCTGAGGGAGG - Intronic
1101966627 12:109286636-109286658 CTTGGGACTCACCTTGAAGTAGG + Exonic
1103176088 12:118864731-118864753 CTTGGGAATCAGCCTGAGCTGGG + Intergenic
1105005787 12:132719758-132719780 CTCGGGAAGCAGCGTGAGGGTGG + Intronic
1105330559 13:19411815-19411837 CTTGTGAGTCAGGGTGAGGGGGG + Intergenic
1105345475 13:19567324-19567346 CTGGGGAAACAGGTTGATGGAGG + Intergenic
1107477693 13:40755499-40755521 CTGGGGAAACAGCCTGATGGAGG + Intronic
1107715570 13:43196181-43196203 CTTGGGAAATAGCTTGAGGGTGG - Intergenic
1107770064 13:43779858-43779880 CTTAGGAATCTGCATGAGGCCGG + Intronic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1111581730 13:90231347-90231369 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
1113838006 13:113342033-113342055 CACAAGAATCAGCTTGAGGGAGG - Intronic
1117521181 14:56552817-56552839 CTTGGGGATGTGCATGAGGGTGG + Intronic
1118280116 14:64420640-64420662 AGTGGGAAGCAGCTGGAGGGAGG - Intronic
1118760108 14:68875712-68875734 CCTGGGAACCAGTTTGAGGGAGG + Intronic
1118966901 14:70595493-70595515 CTTGGAGAACAGCCTGAGGGAGG + Intronic
1119620747 14:76130279-76130301 CTTGAGAAACTGCTGGAGGGAGG - Intergenic
1121843284 14:97152062-97152084 CATGGGGTTCAGGTTGAGGGAGG + Intergenic
1125727052 15:41873498-41873520 CTTGTTAATGAGCCTGAGGGTGG + Exonic
1126277643 15:46902983-46903005 GGTGGGAAGCAGCTTGGGGGAGG - Intergenic
1127867364 15:63043211-63043233 ACTGGGAATCAGTTTGGGGGAGG + Intronic
1128772634 15:70293809-70293831 CTTGGGAATGAGCCTGGGGGTGG + Intergenic
1131003961 15:88960717-88960739 CTTGGAGAACAGCCTGAGGGTGG + Intergenic
1132941907 16:2512733-2512755 CTGGGGAAGGGGCTTGAGGGAGG + Intronic
1137380551 16:47994926-47994948 CTTGGGAAACTGCTTTAGGCAGG - Intergenic
1137804332 16:51289095-51289117 CTTGTCAATGAGCTTGAGAGTGG - Intergenic
1138641955 16:58394689-58394711 CTTGATTATCAGCTTTAGGGAGG + Intronic
1139710843 16:68774712-68774734 CCTGGGCAGCAGCTGGAGGGTGG + Intronic
1140182017 16:72729569-72729591 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
1140402585 16:74683698-74683720 CTTGGGAATCCAGTTGAGTGAGG - Intronic
1140973681 16:80038665-80038687 ATTTGGAAGCAGGTTGAGGGAGG + Intergenic
1142783680 17:2202859-2202881 CTTTGGAATCAACCTGATGGAGG - Intronic
1142803942 17:2361920-2361942 GTGAGGGATCAGCTTGAGGGAGG + Intronic
1143023429 17:3928209-3928231 CTTTGGTATCACCTTGTGGGTGG - Exonic
1143062741 17:4216325-4216347 CTTGGTAATCAGCTTGCTGATGG - Intronic
1145036020 17:19541220-19541242 CTGGGGTATCAGCTTCAGTGAGG + Intronic
1145871371 17:28276366-28276388 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
1147422185 17:40327361-40327383 CTTGGGCCTCACCTTGAGAGAGG + Intronic
1147526349 17:41227320-41227342 CTTGGAAATCTGCTTGAGGGAGG + Exonic
1147526873 17:41233122-41233144 CTTGGGAATCTGCTTGAGGGAGG + Exonic
1147527380 17:41238672-41238694 CTTGGAAATCTGCTTGAGGGAGG + Exonic
1147528501 17:41250326-41250348 CTTGGGAATCTACTTGAGGGAGG + Exonic
1147529026 17:41256036-41256058 CTTGTGAATCAGCTTGAGGGAGG + Exonic
1147529967 17:41266310-41266332 CTTGGGAATCAGCTTGAGGGAGG + Exonic
1147530521 17:41271981-41272003 CTTGTGAATCAGCTTGAGGGAGG + Intergenic
1147530937 17:41276371-41276393 TTTGTGAATCAGCTTGAGTGAGG + Exonic
1147645152 17:42028870-42028892 CGTGGGAAGCAGCATGAGTGGGG - Exonic
1147837325 17:43343636-43343658 CTTGGGAATCATAGTGGGGGAGG + Intergenic
1148077687 17:44948344-44948366 GTTGGAAATCAGCATGAGGTGGG - Intergenic
1148761467 17:50004115-50004137 CTTGGGAATAAGCAGGAGGCAGG - Intergenic
1148834817 17:50460488-50460510 CTTGGGATTAGGCTTGAGGTTGG + Intronic
1149258986 17:54858637-54858659 CTGGGGAACCAGCCTGAAGGTGG + Intergenic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1152210961 17:79003012-79003034 CTGGGGAATCAGTGTGACGGAGG + Intronic
1153907811 18:9678557-9678579 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
1157326573 18:46673516-46673538 CCTGGGAATCAGCATGTGTGAGG - Intronic
1157813898 18:50717389-50717411 CTTGGCAATCAGCTTACAGGAGG + Intronic
1161420719 19:4174785-4174807 CTTGGGCTCCAGCTTGGGGGTGG + Exonic
1162513023 19:11131165-11131187 CTTGGGGATCAGGCTGGGGGAGG + Intronic
1162860945 19:13505711-13505733 CTTGGGAATGGGTTTGTGGGGGG - Intronic
1163987027 19:20963034-20963056 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
1164458608 19:28429076-28429098 TATGGGAACCAGCGTGAGGGAGG + Intergenic
1164806302 19:31119751-31119773 CTTGGGAAGCAGGTAGATGGTGG + Intergenic
1165635295 19:37334988-37335010 CTTGCGGCTGAGCTTGAGGGTGG + Intronic
1165741460 19:38207516-38207538 CTTGGTCCTCAGCTTGAGGTTGG - Exonic
1165743394 19:38216784-38216806 CTTGGTAGACAGCTTGAGGAAGG + Intronic
926114742 2:10205268-10205290 CTGGGGAGTCAGCTTGAATGGGG + Intronic
926242792 2:11101211-11101233 CATGGGAATCAGGTCGAGGCAGG - Intergenic
927094015 2:19734114-19734136 CTTTGGCATGAGCTTGAGGGAGG + Intergenic
929066401 2:37979428-37979450 GTTGGGGTTCAGCATGAGGGAGG + Intronic
931472544 2:62553452-62553474 GTAGGGAATCAGCTGGGGGGGGG + Intergenic
932743097 2:74307039-74307061 CTTGGGAAACAGCCTGAGGGAGG - Intronic
932764928 2:74463449-74463471 CTTGAGAATCAGCCTTAGTGAGG + Intronic
933709381 2:85314483-85314505 CTCAGGACTCAGCTGGAGGGAGG - Intergenic
934759741 2:96847764-96847786 CGTGGCAAGCAGCCTGAGGGAGG - Intronic
936404459 2:112189764-112189786 ATTGGGAATCATCATGAGGTGGG - Intergenic
939565676 2:143783874-143783896 CTTGAGAATCACCTTGTGGTGGG - Intergenic
941175973 2:162197881-162197903 ATTAGGAATAAGCTGGAGGGAGG + Intronic
942971319 2:181961502-181961524 CTTGGAGAACAGCCTGAGGGAGG - Intronic
943548615 2:189311574-189311596 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
945730376 2:213525028-213525050 CTTGGGAGGTAGCTTGTGGGAGG + Intronic
947293695 2:228606501-228606523 CTTTGGTATCAGCATGATGGTGG - Intergenic
948800760 2:240432477-240432499 CTTGGGCAGCAGCCTGAAGGAGG - Intergenic
1171140036 20:22733113-22733135 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
1171515665 20:25731312-25731334 TTTGGGTGTCAACTTGAGGGAGG - Intergenic
1172405705 20:34687323-34687345 CTTGGGTCTCAGATTGAGGAGGG - Intergenic
1173089751 20:39959190-39959212 CCTGGGAATCAGGGTGAGTGAGG - Intergenic
1173176214 20:40766757-40766779 CTTGGAAACCTGCTTGATGGTGG - Intergenic
1173198891 20:40939228-40939250 CTTGAAGATCAGCTTCAGGGTGG - Intergenic
1174093183 20:48066527-48066549 CTTGGACATCAGCTTGCGGAGGG - Intergenic
1174349629 20:49957697-49957719 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
1174428325 20:50449069-50449091 GTAGGGCATCAGCTTGAGGAGGG + Intergenic
1175975969 20:62710693-62710715 CTTGGGAATCAGTTTGGCTGAGG + Intronic
1176023060 20:62972546-62972568 CTTGGGACTCAGCGTGGGGGAGG + Intergenic
1178774223 21:35533870-35533892 ACTGGGAAGCAGCTTGAGTGAGG - Intronic
1178877881 21:36426660-36426682 CGTGGGAATTATCTTGAGGCCGG - Intergenic
1179079301 21:38155642-38155664 CTTGGAAGTCAGCTTGAGAATGG + Intronic
1181792795 22:25281411-25281433 GCAGGGAATCAGATTGAGGGGGG + Intergenic
1181813369 22:25419294-25419316 GCAGGGAATCAGATTGAGGGGGG + Intergenic
1181831358 22:25563459-25563481 GCAGGGAATCAGATTGAGGGGGG + Intergenic
1184988378 22:48151470-48151492 CATGGTAATTAGCTTGATGGTGG + Intergenic
1185291056 22:50028000-50028022 CTTTGGAAGCAGCTGGTGGGTGG + Intronic
949218128 3:1596191-1596213 CTTGGGCTTCAGCTTTAGGAGGG + Intergenic
949947325 3:9201019-9201041 CTCTGGAATTGGCTTGAGGGAGG - Intronic
950403282 3:12787695-12787717 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
954278215 3:49556134-49556156 TTTGGGTTTTAGCTTGAGGGAGG + Intronic
956046091 3:65197471-65197493 CTGGGGAGTCAGGTTGGGGGTGG + Intergenic
959420051 3:106117581-106117603 CTTGGGTATAGGCTGGAGGGTGG + Intergenic
959468127 3:106715508-106715530 CATGGGAAGGACCTTGAGGGAGG + Intergenic
960917810 3:122714849-122714871 TCTGGGAATCAGCTAGAGTGAGG - Intronic
960939399 3:122923539-122923561 GTTGGGAATCAGCTTGTGGCTGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961243981 3:125435649-125435671 CTTGGGAACTGTCTTGAGGGCGG - Intergenic
961392157 3:126558549-126558571 CTTGGGAAGCAGCAACAGGGTGG - Intronic
963771552 3:149391298-149391320 CCTGGGAAACAGATTGTGGGTGG - Intergenic
964483319 3:157162977-157162999 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
964749254 3:160039410-160039432 CTTGTAAAAGAGCTTGAGGGAGG + Intergenic
967123845 3:186407286-186407308 ATTGGCCTTCAGCTTGAGGGAGG + Intergenic
967865597 3:194187439-194187461 CATGGGAGGCAGCTAGAGGGTGG + Intergenic
969121225 4:4913005-4913027 CTTTGGAATCAGGCTGATGGGGG - Intergenic
969141565 4:5078688-5078710 CTTGGGAAGCAGGTAGATGGAGG - Intronic
969306336 4:6328145-6328167 CTTGGGCATCACCTGGTGGGGGG - Intronic
969471082 4:7389689-7389711 CTTGAGAATGAGCAGGAGGGAGG + Intronic
970499589 4:16663977-16663999 CTTGGCAGACAGCTAGAGGGTGG + Intronic
970668464 4:18366520-18366542 CCTGGGAATCTGCCTGGGGGTGG - Intergenic
970908170 4:21241610-21241632 ATTGGGAATTAGCTTGGGAGGGG + Intronic
971497516 4:27282848-27282870 GTTGGGTGTCATCTTGAGGGTGG - Intergenic
973672377 4:53234321-53234343 CTTGGCAAAGAACTTGAGGGAGG + Intronic
975222410 4:71828187-71828209 CTTCGGAATGACCTTGATGGAGG + Intergenic
981818720 4:148861486-148861508 CTTGGGAAATAATTTGAGGGTGG + Intergenic
982026642 4:151258604-151258626 TCTGGGATTCAGCCTGAGGGTGG - Intronic
982270003 4:153576852-153576874 CTAGGGAATCAGCTTGAAAAGGG - Intronic
982330655 4:154178561-154178583 CTTGGCAACCACCATGAGGGTGG - Intergenic
987005645 5:13706919-13706941 TTTGGGCATAAGCCTGAGGGTGG - Intronic
990665127 5:58063390-58063412 CTTGGGAATCACCCTGGAGGTGG - Intergenic
993064497 5:83080690-83080712 CTTGGTTATCAGATTGATGGAGG + Intronic
995215398 5:109589261-109589283 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
995641995 5:114267438-114267460 TTTGAGTATCAGTTTGAGGGTGG + Intergenic
996087961 5:119323363-119323385 GGTGGGAATGTGCTTGAGGGAGG - Intronic
999495414 5:152091671-152091693 TTTGGGAAGCAGCATGATGGAGG + Intergenic
1000198184 5:158980585-158980607 CTTAGTAAACAGCTTGCGGGGGG - Intronic
1002926461 6:1608554-1608576 CTTGGGATTCAGCCTCCGGGAGG + Intergenic
1004311030 6:14544995-14545017 CAAGGGAATCAGATTGGGGGTGG + Intergenic
1004843511 6:19613689-19613711 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
1005341478 6:24847560-24847582 CTTGGGACTCGGCCTGAGGGAGG + Exonic
1005645625 6:27835136-27835158 CTTGAAAAACAGTTTGAGGGAGG - Intergenic
1005761163 6:28969445-28969467 CTTGGAGAACAGCTTGAGGGAGG - Intergenic
1005980603 6:30833708-30833730 CCTGGCAATCAGCTGGAGGAAGG + Intergenic
1006272069 6:32972434-32972456 CTTTGAAATCCTCTTGAGGGCGG - Exonic
1006465342 6:34190733-34190755 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
1006468068 6:34208013-34208035 CTTGGGCCTCATCTTGAGGCTGG - Intergenic
1009522364 6:64699308-64699330 CATGGGAGTCTACTTGAGGGTGG + Intronic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1013192739 6:107817507-107817529 CTTGGGAATCTACTTGAGGCAGG + Intronic
1013667286 6:112361751-112361773 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
1014009191 6:116457636-116457658 CTTGGAAAGCAGCCTGAGGGAGG - Intergenic
1015485045 6:133760188-133760210 ATTGGGAATCACCTGGAGGATGG - Intergenic
1016651758 6:146469908-146469930 CCTGGGAATCAGATTGAGGCTGG - Intergenic
1016836618 6:148483564-148483586 CTTTGGAATCAGGCTGAGTGAGG - Intronic
1018938356 6:168289602-168289624 CTAGGGTGTCAGCTTGGGGGTGG - Intergenic
1019828764 7:3304930-3304952 CATGAGAATCACCTGGAGGGAGG - Intronic
1024730378 7:52247155-52247177 ATGGGGAATCATCTTGAGGGAGG + Intergenic
1031750304 7:125563608-125563630 CCTGGGCACCAGCCTGAGGGTGG - Intergenic
1032202101 7:129829330-129829352 CTTGGGAAACAGCTAGACTGAGG + Intergenic
1034903155 7:154920439-154920461 CCTGGGAATCAGCGTCATGGTGG - Intergenic
1038425488 8:27461601-27461623 CCTGGGAGCCAGCTCGAGGGAGG + Exonic
1039171732 8:34755120-34755142 CTTGAGAATCAGTTTGATGTTGG - Intergenic
1039318845 8:36405578-36405600 CTGGGGAATCAGGCTGAGAGAGG + Intergenic
1039543155 8:38387806-38387828 GTTGGAAATGAGCTTGAAGGAGG + Intronic
1039712279 8:40067723-40067745 CTTGGCACCCAGCTTGAAGGGGG + Intergenic
1040022552 8:42753943-42753965 CTGGGGAATGAGTTTGAGGCAGG + Intronic
1043506723 8:80910026-80910048 CTTGGGACTGAGCCTGAGGCAGG + Intergenic
1043856820 8:85274091-85274113 CTTGGGACTGAGCCTGAGGAGGG + Intronic
1045055175 8:98362574-98362596 CTCGGGAATCAGCTAGACGCTGG - Intergenic
1048070043 8:131011799-131011821 CCTGGGCATCAGCTTCTGGGGGG - Intronic
1048558370 8:135505446-135505468 CCTGGGAATCAGCAGGCGGGAGG - Intronic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048871437 8:138802721-138802743 CTAGGGCTTCATCTTGAGGGTGG + Intronic
1051784786 9:20730553-20730575 CTTTAGAAGCAGCTTGAGAGAGG + Intronic
1052612945 9:30799776-30799798 CTTGGAGAACAGCCTGAGGGAGG - Intergenic
1054957917 9:70934505-70934527 CTTGGGAATCAGCTAGACATAGG + Intronic
1055708797 9:79036722-79036744 CTTGGGGAACAGCCTGAGGGAGG - Intergenic
1056261709 9:84855225-84855247 CATGGGAAACAGATTGGGGGAGG + Intronic
1057739658 9:97700400-97700422 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061420263 9:130469802-130469824 CTTGGGAATGAGCCTGAGTGGGG + Intronic
1061481834 9:130901364-130901386 CCTGGGACCCAGTTTGAGGGTGG - Intergenic
1186182534 X:6986968-6986990 CTTGGCAGGCAGCTGGAGGGAGG - Intergenic
1187904636 X:24054580-24054602 CCTGGGAATCAGCTAGGGTGTGG - Intergenic
1189928693 X:45984317-45984339 CTTGGAGAACAGCCTGAGGGAGG + Intergenic
1192160117 X:68779332-68779354 CTTTGGAATCAGCATGATGTTGG - Intergenic
1192494912 X:71609691-71609713 CTTGGGAATCAGGTTGGAGGAGG + Intronic
1193779284 X:85683195-85683217 CTTGGAGATCTGCTTGAGTGTGG + Intergenic
1195105218 X:101596906-101596928 AGTGGAAATGAGCTTGAGGGAGG + Intergenic
1195900380 X:109791300-109791322 CTTGAGAAGCAGGTTGAGAGAGG + Intergenic
1197093360 X:122565276-122565298 ATTGGGAGTCTACTTGAGGGAGG + Intergenic
1197720014 X:129738799-129738821 AATGGGAATCAGCTTGCTGGAGG + Intergenic
1199529773 X:148833237-148833259 CATGCGAATCACCTTGAGAGGGG - Intronic
1200805057 Y:7424951-7424973 CTTGGGAAGGAGGTTGAGGCGGG + Intergenic