ID: 1147533118

View in Genome Browser
Species Human (GRCh38)
Location 17:41298723-41298745
Sequence CTCTGTCCTTGCCATAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147533110_1147533118 17 Left 1147533110 17:41298683-41298705 CCAGTACAACAAGGCAGGAAACC No data
Right 1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG No data
1147533106_1147533118 26 Left 1147533106 17:41298674-41298696 CCGATTCCTCCAGTACAACAAGG No data
Right 1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG No data
1147533113_1147533118 -4 Left 1147533113 17:41298704-41298726 CCCTGGGATACAGAAAGCCCTCT 0: 49
1: 77
2: 134
3: 110
4: 334
Right 1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG No data
1147533114_1147533118 -5 Left 1147533114 17:41298705-41298727 CCTGGGATACAGAAAGCCCTCTG 0: 152
1: 263
2: 195
3: 152
4: 400
Right 1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG No data
1147533109_1147533118 20 Left 1147533109 17:41298680-41298702 CCTCCAGTACAACAAGGCAGGAA No data
Right 1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147533118 Original CRISPR CTCTGTCCTTGCCATAAGGC AGG Intergenic
No off target data available for this crispr