ID: 1147533772

View in Genome Browser
Species Human (GRCh38)
Location 17:41304252-41304274
Sequence ACCGGACCTGGTTGGTGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147533772_1147533781 18 Left 1147533772 17:41304252-41304274 CCGCATCACCAACCAGGTCCGGT No data
Right 1147533781 17:41304293-41304315 TTCTGGCCGGTTCACGCTGGAGG No data
1147533772_1147533780 15 Left 1147533772 17:41304252-41304274 CCGCATCACCAACCAGGTCCGGT No data
Right 1147533780 17:41304290-41304312 ACGTTCTGGCCGGTTCACGCTGG No data
1147533772_1147533783 28 Left 1147533772 17:41304252-41304274 CCGCATCACCAACCAGGTCCGGT No data
Right 1147533783 17:41304303-41304325 TTCACGCTGGAGGCACATGACGG No data
1147533772_1147533777 5 Left 1147533772 17:41304252-41304274 CCGCATCACCAACCAGGTCCGGT No data
Right 1147533777 17:41304280-41304302 ACACCAGCCAACGTTCTGGCCGG No data
1147533772_1147533776 1 Left 1147533772 17:41304252-41304274 CCGCATCACCAACCAGGTCCGGT No data
Right 1147533776 17:41304276-41304298 TTCTACACCAGCCAACGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147533772 Original CRISPR ACCGGACCTGGTTGGTGATG CGG (reversed) Intergenic
No off target data available for this crispr