ID: 1147534732

View in Genome Browser
Species Human (GRCh38)
Location 17:41312293-41312315
Sequence ACTTTTGGACAGGCCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147534727_1147534732 18 Left 1147534727 17:41312252-41312274 CCATTCTTTTAAATGTGGCTCTC No data
Right 1147534732 17:41312293-41312315 ACTTTTGGACAGGCCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147534732 Original CRISPR ACTTTTGGACAGGCCTGCAG AGG Intergenic
No off target data available for this crispr