ID: 1147536732

View in Genome Browser
Species Human (GRCh38)
Location 17:41326637-41326659
Sequence TCGGGCTCACCCTAAGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147536725_1147536732 4 Left 1147536725 17:41326610-41326632 CCACACCTGTGTCCCCACAGATC No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536729_1147536732 -8 Left 1147536729 17:41326622-41326644 CCCCACAGATCTCTCTCGGGCTC No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536731_1147536732 -10 Left 1147536731 17:41326624-41326646 CCACAGATCTCTCTCGGGCTCAC No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536723_1147536732 8 Left 1147536723 17:41326606-41326628 CCTCCCACACCTGTGTCCCCACA No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536721_1147536732 24 Left 1147536721 17:41326590-41326612 CCTGGACGAGCCAGGGCCTCCCA No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536726_1147536732 -1 Left 1147536726 17:41326615-41326637 CCTGTGTCCCCACAGATCTCTCT No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536722_1147536732 14 Left 1147536722 17:41326600-41326622 CCAGGGCCTCCCACACCTGTGTC No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536724_1147536732 5 Left 1147536724 17:41326609-41326631 CCCACACCTGTGTCCCCACAGAT No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536720_1147536732 28 Left 1147536720 17:41326586-41326608 CCAGCCTGGACGAGCCAGGGCCT No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data
1147536730_1147536732 -9 Left 1147536730 17:41326623-41326645 CCCACAGATCTCTCTCGGGCTCA No data
Right 1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147536732 Original CRISPR TCGGGCTCACCCTAAGCCTG TGG Intergenic
No off target data available for this crispr