ID: 1147537412

View in Genome Browser
Species Human (GRCh38)
Location 17:41329524-41329546
Sequence GGCTGACCACACTGCGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147537400_1147537412 14 Left 1147537400 17:41329487-41329509 CCATTTCCCAGAAGGACCAGCTG No data
Right 1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG No data
1147537403_1147537412 7 Left 1147537403 17:41329494-41329516 CCAGAAGGACCAGCTGGCCACCT No data
Right 1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG No data
1147537402_1147537412 8 Left 1147537402 17:41329493-41329515 CCCAGAAGGACCAGCTGGCCACC No data
Right 1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG No data
1147537397_1147537412 27 Left 1147537397 17:41329474-41329496 CCCTGGGATGGCACCATTTCCCA No data
Right 1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG No data
1147537407_1147537412 -10 Left 1147537407 17:41329511-41329533 CCACCTACTGGCAGGCTGACCAC No data
Right 1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG No data
1147537398_1147537412 26 Left 1147537398 17:41329475-41329497 CCTGGGATGGCACCATTTCCCAG No data
Right 1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG No data
1147537405_1147537412 -2 Left 1147537405 17:41329503-41329525 CCAGCTGGCCACCTACTGGCAGG No data
Right 1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG No data
1147537396_1147537412 28 Left 1147537396 17:41329473-41329495 CCCCTGGGATGGCACCATTTCCC No data
Right 1147537412 17:41329524-41329546 GGCTGACCACACTGCGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147537412 Original CRISPR GGCTGACCACACTGCGGAAG GGG Intergenic
No off target data available for this crispr