ID: 1147538046

View in Genome Browser
Species Human (GRCh38)
Location 17:41333699-41333721
Sequence TCACCTACATGATTTGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147538045_1147538046 -1 Left 1147538045 17:41333677-41333699 CCTCAGGATCATTGTGAGGATGT No data
Right 1147538046 17:41333699-41333721 TCACCTACATGATTTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147538046 Original CRISPR TCACCTACATGATTTGCTCA TGG Intergenic