ID: 1147538046 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:41333699-41333721 |
| Sequence | TCACCTACATGATTTGCTCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147538045_1147538046 | -1 | Left | 1147538045 | 17:41333677-41333699 | CCTCAGGATCATTGTGAGGATGT | No data | ||
| Right | 1147538046 | 17:41333699-41333721 | TCACCTACATGATTTGCTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147538046 | Original CRISPR | TCACCTACATGATTTGCTCA TGG | Intergenic | ||