ID: 1147538507

View in Genome Browser
Species Human (GRCh38)
Location 17:41336130-41336152
Sequence ACCATGATGTCCCACCTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147538506_1147538507 8 Left 1147538506 17:41336099-41336121 CCTCACTGGATTTTGGTTGTGTC No data
Right 1147538507 17:41336130-41336152 ACCATGATGTCCCACCTTCCCGG No data
1147538505_1147538507 13 Left 1147538505 17:41336094-41336116 CCATTCCTCACTGGATTTTGGTT No data
Right 1147538507 17:41336130-41336152 ACCATGATGTCCCACCTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147538507 Original CRISPR ACCATGATGTCCCACCTTCC CGG Intergenic
No off target data available for this crispr