ID: 1147541971

View in Genome Browser
Species Human (GRCh38)
Location 17:41367943-41367965
Sequence GTCGATCTGCACCACCAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 2, 2: 2, 3: 4, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147541970_1147541971 -10 Left 1147541970 17:41367930-41367952 CCAGCTTGGCATTGTCGATCTGC 0: 2
1: 1
2: 7
3: 6
4: 78
Right 1147541971 17:41367943-41367965 GTCGATCTGCACCACCAGCCTGG 0: 1
1: 2
2: 2
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147541971 Original CRISPR GTCGATCTGCACCACCAGCC TGG Exonic
900186100 1:1333947-1333969 GGCCAGCAGCACCACCAGCCAGG - Exonic
900622334 1:3593152-3593174 GCCCATCTCCATCACCAGCCTGG - Intronic
901003199 1:6159300-6159322 GTCGCTCTGTCCCCCCAGCCAGG + Intronic
902928914 1:19716729-19716751 CTCCATCTGCACGGCCAGCCTGG - Intronic
903889372 1:26559177-26559199 GTCACTCGGCACCACCACCCTGG - Intronic
906032667 1:42733746-42733768 GTGGATGTGCAGCACCGGCCAGG + Exonic
906531124 1:46524660-46524682 CCCCATCTGCACCCCCAGCCAGG - Intergenic
910323543 1:85977056-85977078 GACAATCTCCAGCACCAGCCTGG + Intronic
914226941 1:145728390-145728412 GTCTATCCTCACCACCAGACTGG - Exonic
922790542 1:228308561-228308583 GACAACCTGCCCCACCAGCCTGG - Intronic
1065916327 10:30357357-30357379 GACGCTCTGCACCTGCAGCCAGG - Intronic
1068030114 10:51696275-51696297 GTCCATTTGCTCCACCAGACAGG - Exonic
1072021245 10:91404756-91404778 GTAGAACTGCAACACCAGCTTGG - Intergenic
1073027410 10:100498082-100498104 GCAGATCTGTACCCCCAGCCTGG + Exonic
1076471918 10:130724986-130725008 GTAGATCTGCAGAACCTGCCAGG - Intergenic
1079008631 11:16810500-16810522 GCTGAACTGCACCAGCAGCCTGG - Intronic
1080646434 11:34191550-34191572 GTAGTTCTGCACCCCCAGACAGG - Intronic
1084399468 11:68935282-68935304 GTCCACCTGAAACACCAGCCGGG - Exonic
1084611114 11:70203599-70203621 GTCGTTCTGCTCCAGCAGCATGG - Exonic
1085742924 11:79092219-79092241 GTCAGTCTGCCCCACCAGACTGG - Intronic
1090364872 11:126197416-126197438 ATGGATGTGCATCACCAGCCAGG - Intergenic
1092852508 12:12643193-12643215 GCCCTTCTGCACCCCCAGCCAGG - Exonic
1093599271 12:21002044-21002066 GACATTCTGCAGCACCAGCCTGG - Intergenic
1095921953 12:47540626-47540648 GTCATTCTGCTGCACCAGCCTGG + Intergenic
1095989814 12:48027052-48027074 GTCTATGTGCATCCCCAGCCAGG - Intergenic
1096956439 12:55530528-55530550 GACATTCTGCAGCACCAGCCTGG + Intergenic
1101912022 12:108867138-108867160 GTCAATAGGCACCAGCAGCCAGG + Intronic
1103995577 12:124827879-124827901 GTCCATCTGTATCACCTGCCTGG + Intronic
1112099381 13:96170233-96170255 TTCAATCTGCACCACCAGGTGGG + Intronic
1114530109 14:23390159-23390181 GTCGATCTGCTCGCCCAGCTCGG + Exonic
1114535539 14:23419947-23419969 GTCGATCTGCTCGCCCAGCTCGG + Exonic
1120431808 14:84427779-84427801 ATTGGTCTGCAACACCAGCCTGG - Intergenic
1124490551 15:30152302-30152324 GACGCTCTGCACCTGCAGCCAGG + Intergenic
1124752982 15:32386027-32386049 GACGCTCTGCACCTGCAGCCAGG - Intergenic
1124974725 15:34521727-34521749 GACGCTCTGCACCTGCAGCCAGG - Intergenic
1129468846 15:75738950-75738972 GACGCTCTGCACCTGCAGCCAGG + Intergenic
1131891042 15:96971587-96971609 GTGCAACTGCACCTCCAGCCTGG - Intergenic
1135046449 16:19159723-19159745 GACGATGCCCACCACCAGCCAGG - Intronic
1136418691 16:30118664-30118686 GCCAACCTGCACCACCAGCTGGG + Intronic
1139398568 16:66661254-66661276 GTCCATCCGCAGCACCAGTCTGG - Intronic
1140752450 16:78037925-78037947 GTAGAATAGCACCACCAGCCTGG + Intronic
1145900036 17:28484730-28484752 GTAGCTCTGGACCACTAGCCTGG - Intronic
1147540006 17:41349381-41349403 GTCGATCTGCACCACAAGCCTGG + Exonic
1147541971 17:41367943-41367965 GTCGATCTGCACCACCAGCCTGG + Exonic
1147543648 17:41381748-41381770 GTCAATGTTCACCACCAGCCTGG + Exonic
1147545331 17:41396948-41396970 GTCGATCTGCACCACAAGCCTGG + Exonic
1147556041 17:41479734-41479756 GTCAATCTCCACCACCAGCCTGG + Exonic
1147557481 17:41488677-41488699 ATCAATCTGCAGGACCAGCCTGG + Exonic
1147563948 17:41525226-41525248 GTCGATCTGCAGGACAATCCTGG + Exonic
1151138511 17:71970302-71970324 GTGGATCTGGCCCACCAGCAAGG + Intergenic
1157394738 18:47332111-47332133 GTCTACCTGCAATACCAGCCTGG - Intergenic
1159678870 18:71321555-71321577 GTGTGTCTGCACAACCAGCCAGG - Intergenic
1160956975 19:1698354-1698376 CTCCACGTGCACCACCAGCCGGG - Intergenic
1167468925 19:49664788-49664810 GTCCAGCTGCGACACCAGCCAGG + Exonic
926581345 2:14634545-14634567 GGCGTTCTGCACCACCAGCTCGG - Exonic
932621433 2:73266664-73266686 GTCGATCTGCACCACCTCCCTGG + Exonic
934936950 2:98472497-98472519 AGACATCTGCACCACCAGCCTGG - Intronic
948439279 2:237976199-237976221 CTCCATCTGCAGCACAAGCCAGG + Intronic
1172607925 20:36227615-36227637 GTAATTCTCCACCACCAGCCTGG + Intronic
1175312745 20:58023397-58023419 CTCGGTTTGCACCACCAGTCTGG + Intergenic
1175540666 20:59745759-59745781 GTGGATCTGAGCCACCTGCCAGG - Intronic
1176658618 21:9613024-9613046 GACATTCTGCAGCACCAGCCTGG - Intergenic
1178738049 21:35170655-35170677 GTCAAGCTCCACCACCACCCAGG - Intronic
1178954438 21:37009925-37009947 GTCGCTCTGCGCAACCAGCTGGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1181498643 22:23302674-23302696 GGCGCTCTGCGACACCAGCCTGG - Intronic
950322707 3:12071253-12071275 GTGGATCTGCAGCTCCATCCTGG + Intronic
958925023 3:100148218-100148240 ATCGATGTGCACCACCACACCGG + Intronic
960969855 3:123131573-123131595 GATGATCTGCAGCTCCAGCCTGG - Intronic
962620661 3:137174862-137174884 GGCGCTCTGAACCCCCAGCCAGG + Intergenic
963939915 3:151087156-151087178 GTCGCCCAGCACCCCCAGCCTGG - Intronic
967749337 3:193095716-193095738 GTAAATCTGCACCATCACCCTGG - Intergenic
968446401 4:654368-654390 GTGGGTCTTCACGACCAGCCTGG - Intronic
968705459 4:2075501-2075523 ATGGATCTGGGCCACCAGCCTGG + Exonic
969795828 4:9527700-9527722 GCCGGTCTTCAGCACCAGCCTGG + Intergenic
979584770 4:122403296-122403318 GACGTTCTCCAGCACCAGCCTGG - Intronic
983092244 4:163517646-163517668 GTTGATCTGCACCAACAGGATGG + Intronic
985006682 4:185541340-185541362 GTTGATCTGCACAGCCAGACCGG - Intergenic
985710363 5:1424378-1424400 GTCGTTCTGCTCCCCCAGCAAGG + Intronic
1000327274 5:160181927-160181949 GACGATCTGAACCAGCAGTCGGG - Intergenic
1002314371 5:178333711-178333733 GTCCATCTGCAGAACAAGCCTGG + Intronic
1002419104 5:179136277-179136299 GCCGGGCTGCACCAACAGCCTGG - Intronic
1003394500 6:5741574-5741596 GTGGGTATGCACCAGCAGCCAGG + Intronic
1008677262 6:53833119-53833141 CTCCATCTGCACCATCAGTCTGG + Intronic
1010358509 6:74965083-74965105 GACGTTCTCCAGCACCAGCCTGG - Intergenic
1013111055 6:107065544-107065566 GTCGATCTACACAGCCAGGCGGG + Exonic
1013495050 6:110689788-110689810 GACATTCTGCAGCACCAGCCTGG + Intronic
1017707653 6:157138627-157138649 GTCAATCTGCATCACCATCCAGG - Intronic
1019481100 7:1267204-1267226 GACCACCTGCACCTCCAGCCAGG - Intergenic
1041388923 8:57331931-57331953 GTCCAGCTCCACTACCAGCCTGG + Intergenic
1041853528 8:62421245-62421267 TTCTATCTGCAACACCTGCCTGG - Intronic
1045502649 8:102755366-102755388 GTGCTTCTGCACCACCAGGCTGG + Intergenic
1062367503 9:136218254-136218276 GTGCATCTGCCCCACCAGCCAGG - Intronic
1203636345 Un_KI270750v1:116603-116625 GACATTCTGCAGCACCAGCCTGG - Intergenic
1186586160 X:10875367-10875389 GGCCATCTGCACCATAAGCCAGG - Intergenic
1191662795 X:63668094-63668116 GTCCATCCACTCCACCAGCCAGG + Intronic