ID: 1147546629

View in Genome Browser
Species Human (GRCh38)
Location 17:41406944-41406966
Sequence ATATACCCCTTTAAGCACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147546629_1147546631 2 Left 1147546629 17:41406944-41406966 CCTTAGTGCTTAAAGGGGTATAT No data
Right 1147546631 17:41406969-41406991 GCCCTCTGATGCTTTTCACAGGG No data
1147546629_1147546630 1 Left 1147546629 17:41406944-41406966 CCTTAGTGCTTAAAGGGGTATAT No data
Right 1147546630 17:41406968-41406990 AGCCCTCTGATGCTTTTCACAGG No data
1147546629_1147546634 11 Left 1147546629 17:41406944-41406966 CCTTAGTGCTTAAAGGGGTATAT No data
Right 1147546634 17:41406978-41407000 TGCTTTTCACAGGGCTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147546629 Original CRISPR ATATACCCCTTTAAGCACTA AGG (reversed) Intergenic
No off target data available for this crispr