ID: 1147549369

View in Genome Browser
Species Human (GRCh38)
Location 17:41428609-41428631
Sequence ATGATGGTGTTGATGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147549362_1147549369 5 Left 1147549362 17:41428581-41428603 CCCGTGAAAACCACAAGGGAGTC No data
Right 1147549369 17:41428609-41428631 ATGATGGTGTTGATGAAACCTGG No data
1147549361_1147549369 6 Left 1147549361 17:41428580-41428602 CCCCGTGAAAACCACAAGGGAGT No data
Right 1147549369 17:41428609-41428631 ATGATGGTGTTGATGAAACCTGG No data
1147549363_1147549369 4 Left 1147549363 17:41428582-41428604 CCGTGAAAACCACAAGGGAGTCA No data
Right 1147549369 17:41428609-41428631 ATGATGGTGTTGATGAAACCTGG No data
1147549367_1147549369 -5 Left 1147549367 17:41428591-41428613 CCACAAGGGAGTCAGGGGATGAT No data
Right 1147549369 17:41428609-41428631 ATGATGGTGTTGATGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147549369 Original CRISPR ATGATGGTGTTGATGAAACC TGG Intergenic
No off target data available for this crispr