ID: 1147550695

View in Genome Browser
Species Human (GRCh38)
Location 17:41439360-41439382
Sequence CTTTCATCACAGGAGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147550682_1147550695 29 Left 1147550682 17:41439308-41439330 CCCACACTTGTCTGCCTCCACCA 0: 1
1: 0
2: 1
3: 34
4: 260
Right 1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG 0: 1
1: 0
2: 1
3: 14
4: 112
1147550689_1147550695 9 Left 1147550689 17:41439328-41439350 CCAGCTGGCGCAGGGAGCGCTCA 0: 1
1: 0
2: 1
3: 13
4: 111
Right 1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG 0: 1
1: 0
2: 1
3: 14
4: 112
1147550683_1147550695 28 Left 1147550683 17:41439309-41439331 CCACACTTGTCTGCCTCCACCAG 0: 1
1: 1
2: 0
3: 35
4: 294
Right 1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG 0: 1
1: 0
2: 1
3: 14
4: 112
1147550688_1147550695 12 Left 1147550688 17:41439325-41439347 CCACCAGCTGGCGCAGGGAGCGC 0: 1
1: 0
2: 3
3: 19
4: 186
Right 1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG 0: 1
1: 0
2: 1
3: 14
4: 112
1147550687_1147550695 15 Left 1147550687 17:41439322-41439344 CCTCCACCAGCTGGCGCAGGGAG 0: 1
1: 0
2: 3
3: 26
4: 272
Right 1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG 0: 1
1: 0
2: 1
3: 14
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147550695 Original CRISPR CTTTCATCACAGGAGGTACA GGG Intronic
900508528 1:3043842-3043864 CTTTCATGAAAGAAGGTCCATGG - Intergenic
905146161 1:35888354-35888376 CTCTTATCAGAGGAGGAACAAGG - Intronic
910418345 1:87026623-87026645 CTTTCATCTCATTAGTTACAAGG + Intronic
910761196 1:90733194-90733216 TTTTAATCAAAGGAGGTACAGGG + Intergenic
913298266 1:117343502-117343524 CTTTCCTCACAGGTGGGAGATGG + Intergenic
913447852 1:118969148-118969170 CTTTGAGCTCAGTAGGTACAGGG - Intronic
915457418 1:156050160-156050182 TTTTGAACACTGGAGGTACAGGG - Intronic
921225120 1:213011208-213011230 CTTCCATATCAGGAGGAACAAGG + Intronic
922466698 1:225849433-225849455 CTTCCATGCCAGGAGGTACAAGG + Intronic
1064316095 10:14258402-14258424 ATTTCATCAAAGCAGATACAAGG + Intronic
1065164131 10:22957203-22957225 CTGTCATCACACGGGGTCCAGGG - Intronic
1065459091 10:25936853-25936875 CTTTAAGCACAGTAGGTACCTGG + Intronic
1066413943 10:35201657-35201679 CTTTCATGTCAGGAGCTAGATGG + Intronic
1068010944 10:51450391-51450413 CTTTGGTCATAGGAGGAACAGGG - Intronic
1068630305 10:59291026-59291048 CTTTCAACACAAGAAGTCCAAGG + Intronic
1068809383 10:61238784-61238806 CTTTGAGGACAGGAGGTAAAAGG - Intergenic
1069632670 10:69906507-69906529 CTTACAGCACAGCAGGTCCAGGG + Intronic
1075048985 10:119168001-119168023 CATTCATTGCAGGAGTTACACGG + Exonic
1077238887 11:1500370-1500392 CTTTAAACACAGGCGGTTCACGG + Intronic
1080467433 11:32510848-32510870 ATTTCATCCAAGGAGGTCCAGGG + Intergenic
1080894820 11:36440342-36440364 CTTTAAACACAGGAGGTACTAGG + Intronic
1085157903 11:74312673-74312695 CTTTCCTGGCAGAAGGTACATGG + Intergenic
1086528382 11:87755476-87755498 CTTTCATGCCAGGAGTTACCAGG - Intergenic
1090735262 11:129607268-129607290 TTTTCCTCATAGGAGGCACATGG - Intergenic
1091319792 11:134641253-134641275 CTTTCTTCCCAGGATGTCCAGGG - Intergenic
1093519395 12:20030630-20030652 TTTCCATCTCAGGAGGAACATGG - Intergenic
1096979568 12:55720503-55720525 CTTTCGCCACAGGAGGTAAGTGG + Exonic
1098031419 12:66258643-66258665 CTTTCATCAAAAGGTGTACAAGG - Intergenic
1098081232 12:66787626-66787648 CTTACATGACAGAAGGAACAAGG - Intronic
1107384031 13:39888976-39888998 CTTTCATCTCTGAAGGTAGAGGG + Intergenic
1109193359 13:59351517-59351539 CTTTAATAAAAGGAGTTACAGGG - Intergenic
1109416732 13:62050678-62050700 CTTTCATGGCAGCAGGTAGAAGG - Intergenic
1109527491 13:63596119-63596141 CTTTCATCAGAGAGGGGACATGG + Intergenic
1111315083 13:86545298-86545320 TTTTTATCACAGTAGATACATGG + Intergenic
1113662429 13:112116760-112116782 CCTTCCTTACAGGAGGGACAGGG - Intergenic
1115185521 14:30683770-30683792 CCTACTTCTCAGGAGGTACAGGG - Intronic
1121329251 14:93039825-93039847 GTTTCAGTACAGGAAGTACAGGG + Intronic
1121915400 14:97833158-97833180 CTCACATCACAGGAGGAAAAGGG - Intergenic
1123474698 15:20581655-20581677 CTTTCTTCAAAGGAGGAGCAGGG - Intergenic
1123643313 15:22418702-22418724 CTTTCTTCAAAGGAGGAGCAGGG + Intergenic
1129755589 15:78096992-78097014 CTATCATCAGAATAGGTACATGG + Intronic
1129881921 15:79012517-79012539 TTTTCTTCACAGGAGGACCAGGG - Exonic
1136614716 16:31391089-31391111 CTTTCAGCACAAGAGGGAGAAGG + Intergenic
1140675153 16:77320673-77320695 ATTTCATCACTGAAGATACATGG - Intronic
1144614784 17:16758921-16758943 CTTCCTTCACAGGAAGCACAAGG - Intronic
1144897921 17:18556753-18556775 CTTCCTTCACAGGAAGCACAAGG + Intergenic
1145134449 17:20388961-20388983 CTTCCTTCACAGGAAGCACAAGG - Intergenic
1146637978 17:34520084-34520106 CTTTCATCACTGGATGCACATGG - Intergenic
1147548739 17:41422935-41422957 CTTCCGTCACAGGAGGCACAGGG + Intronic
1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG + Intronic
1151170003 17:72237815-72237837 ATTTCACCAAAGGAGGTAAATGG - Intergenic
1151745703 17:76010596-76010618 CTTTCATCTCAGGAAAAACATGG - Intronic
1157078499 18:44495332-44495354 CTCACATCACAGGAGGTCAAAGG + Intergenic
1160689787 19:456260-456282 CCTACATCACAGCAGGCACAGGG - Intronic
1162457138 19:10792183-10792205 CTTTCCTCACATGAAGTAAAGGG - Intronic
1163978524 19:20875880-20875902 CATTTATCACAGGGGGAACATGG + Intergenic
1164818152 19:31222673-31222695 CTTCCTTCATAGGAGGTACTCGG + Intergenic
925316615 2:2931554-2931576 CATCCAGCACAGGAGGTCCAGGG + Intergenic
925863298 2:8201239-8201261 CTTTAATGAGAGCAGGTACAGGG + Intergenic
926043984 2:9696145-9696167 CTTTGAACACAGGTTGTACAAGG - Intergenic
926672246 2:15587422-15587444 CTTACATGGCAGGAGGTACAAGG - Intergenic
930250149 2:49026006-49026028 CTGTCATCTGAGGAGGTAAAAGG - Intronic
934070290 2:88377588-88377610 ATTTTATCACAGCAGGTACATGG - Intergenic
940060022 2:149554820-149554842 CTTTCTTAACAAGAGGTCCATGG + Intergenic
942740697 2:179174226-179174248 CTTTCATCTCCGAAGGTACTGGG - Intronic
947962503 2:234251445-234251467 CTGTCATCAAAGGAGGTCCGTGG - Intergenic
948221934 2:236276874-236276896 CCTTCTTCTCAGGTGGTACAAGG - Intergenic
948383912 2:237569871-237569893 CTCTGATGACAGGAAGTACAGGG - Intergenic
1170692025 20:18624777-18624799 CTTGCATAACAGGAGATCCAAGG - Intronic
1173783353 20:45774626-45774648 TTTTTATAACAGGAGATACAAGG - Intronic
1175304240 20:57965095-57965117 CTGCCATCCCAGGGGGTACAGGG + Intergenic
1177729898 21:25015284-25015306 CTTTCCTCCCCGGAGGTCCAGGG + Intergenic
1178297028 21:31418654-31418676 CTTTAAACACAGGAGTTAGAGGG + Intronic
1184929248 22:47668678-47668700 CATTCATCACAGGACGTCAAGGG + Intergenic
958463492 3:94428415-94428437 TTTTCATCACAGCATGCACAAGG - Intergenic
960604519 3:119491082-119491104 CTTTCATGACAGGAGGAGCTAGG + Intronic
963870913 3:150411855-150411877 TTTTGATTAAAGGAGGTACAAGG + Intronic
964711229 3:159673968-159673990 CTTTCATAACAGGGGGTACCAGG - Intronic
964879821 3:161410973-161410995 CTTTAATAAGAGGAGGTATAGGG + Intergenic
969116529 4:4873784-4873806 CCTTCATTCCAGGAGGAACAGGG + Intergenic
976902374 4:90194865-90194887 TTTTCTTCAGAGGAGTTACAAGG - Intronic
977303598 4:95296741-95296763 CTGTAATCAAAGGAGGCACAAGG - Intronic
977894941 4:102352727-102352749 CTTTCTTCTCATCAGGTACAGGG - Intronic
979032223 4:115664611-115664633 CTTTCATCACAGTGGGTGCAAGG - Intergenic
979395994 4:120189933-120189955 CTGTCATCACAGGAAGTCAATGG + Intergenic
990419129 5:55614607-55614629 CATTCATCCCAGTAGGTTCATGG - Intergenic
992328346 5:75686517-75686539 CTTTCATCAGAGGAGTTCAAAGG - Intronic
1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG + Intronic
1001056434 5:168453956-168453978 TTGTCATCACAGGAGGTATGAGG + Exonic
1001843119 5:174897336-174897358 CTTTGTTTACAGCAGGTACAAGG + Intergenic
1004529072 6:16436802-16436824 TTTTGATCAGAGGAGGTACAGGG + Intronic
1005267728 6:24130068-24130090 TTAATATCACAGGAGGTACATGG - Intronic
1009936616 6:70241972-70241994 CTTTCATTCCAGGAAGTCCAGGG + Exonic
1011483862 6:87821748-87821770 TATTCATCACAGGAGATAAAAGG + Intergenic
1013028161 6:106300865-106300887 CTTTCAGGACAGGTGGTAAAAGG - Intronic
1013468817 6:110442432-110442454 CTTTTATCACTGGACCTACAAGG - Exonic
1013904091 6:115194937-115194959 CTTTCTTCCCAGGAGGTCCCTGG - Intergenic
1014512279 6:122338317-122338339 CTTACATAACATGAGGAACAGGG + Intergenic
1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG + Intergenic
1015955427 6:138593180-138593202 TATTAATCACAGGAGGTAGACGG + Intronic
1018043752 6:159948055-159948077 CTTTCATCCCAGGTGGTGCCTGG + Intergenic
1023348563 7:39296517-39296539 CTTTTATCCCAAGAGCTACAAGG - Intronic
1023458011 7:40362493-40362515 CTTTAATCACAGCAGGTTGATGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1032473749 7:132198449-132198471 CATGCAACACAGGAGGAACAGGG - Intronic
1033655967 7:143374664-143374686 GATTCCTCACTGGAGGTACAGGG - Intergenic
1034232057 7:149538105-149538127 CTTACATCACAGAAGGCACAAGG - Intergenic
1037525376 8:19719325-19719347 CTCGCATCACAGGGAGTACAGGG - Intronic
1037636303 8:20703725-20703747 CATTCAGCTCAGGAGGTAAAGGG + Intergenic
1038615112 8:29086554-29086576 CTTTCATGACAGGTGGGAAATGG + Intronic
1046770985 8:118116334-118116356 CTTTGACCAGAGGAGTTACATGG - Intergenic
1046933105 8:119860614-119860636 CATTCATCACAGCAGTTGCAGGG - Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1050053765 9:1630779-1630801 CCTTCATCTTAGGAGGCACAGGG - Intergenic
1050335843 9:4589382-4589404 CCTTCATCACATCAGGGACACGG - Intronic
1050937986 9:11423405-11423427 ATATCATCACAGGAGGAACATGG + Intergenic
1058321861 9:103642052-103642074 CTTTAATGGAAGGAGGTACAGGG - Intergenic
1058452087 9:105106526-105106548 CTTACATAACAGAAGGTAGAAGG + Intergenic
1058673306 9:107379284-107379306 CTTTCATCACATGAGGGCCATGG + Intergenic
1059968591 9:119641048-119641070 CTTTCCTCACATGACATACAGGG + Intergenic
1062466005 9:136681927-136681949 CTTTGCACACAGGAGGTGCAGGG - Intronic
1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG + Intronic
1193191281 X:78573761-78573783 CTGTCAAAACAGGTGGTACATGG - Intergenic
1194185699 X:90772522-90772544 CTTTCAGTACAGGAGATGCAAGG - Intergenic
1195020936 X:100827725-100827747 CTTTCATGACAGGAGGTCCATGG + Intronic
1199709318 X:150457353-150457375 CTTGCATCATTGGAGGTATATGG - Intronic
1200532317 Y:4354601-4354623 CTTTCAGTACAGGAGATGCAAGG - Intergenic
1200576315 Y:4892894-4892916 CAATCATCACAGAAGGCACATGG + Intergenic