ID: 1147552332

View in Genome Browser
Species Human (GRCh38)
Location 17:41452492-41452514
Sequence GGTCCACTTAACCACTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147552332_1147552335 20 Left 1147552332 17:41452492-41452514 CCAACACAGTGGTTAAGTGGACC No data
Right 1147552335 17:41452535-41452557 TTTACCAGCTCTGAGACTTTAGG No data
1147552332_1147552333 -6 Left 1147552332 17:41452492-41452514 CCAACACAGTGGTTAAGTGGACC No data
Right 1147552333 17:41452509-41452531 TGGACCTGTGTCACGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147552332 Original CRISPR GGTCCACTTAACCACTGTGT TGG (reversed) Intergenic
No off target data available for this crispr