ID: 1147555144

View in Genome Browser
Species Human (GRCh38)
Location 17:41473919-41473941
Sequence CTGTTTCAACAAAAGCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147555142_1147555144 -9 Left 1147555142 17:41473905-41473927 CCAGGAGGAAGGGCCTGTTTCAA No data
Right 1147555144 17:41473919-41473941 CTGTTTCAACAAAAGCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147555144 Original CRISPR CTGTTTCAACAAAAGCAGAT AGG Intergenic
No off target data available for this crispr