ID: 1147555170

View in Genome Browser
Species Human (GRCh38)
Location 17:41474107-41474129
Sequence AGCTGATAGAAGGTGCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147555170_1147555173 30 Left 1147555170 17:41474107-41474129 CCACGTAGCACCTTCTATCAGCT No data
Right 1147555173 17:41474160-41474182 AAGGATGACCAGATACTTGAAGG No data
1147555170_1147555172 11 Left 1147555170 17:41474107-41474129 CCACGTAGCACCTTCTATCAGCT No data
Right 1147555172 17:41474141-41474163 CGTCATAAAATATAAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147555170 Original CRISPR AGCTGATAGAAGGTGCTACG TGG (reversed) Intergenic
No off target data available for this crispr