ID: 1147555171

View in Genome Browser
Species Human (GRCh38)
Location 17:41474117-41474139
Sequence GACACTAAAAAGCTGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147555171_1147555172 1 Left 1147555171 17:41474117-41474139 CCTTCTATCAGCTTTTTAGTGTC No data
Right 1147555172 17:41474141-41474163 CGTCATAAAATATAAACAAAAGG No data
1147555171_1147555173 20 Left 1147555171 17:41474117-41474139 CCTTCTATCAGCTTTTTAGTGTC No data
Right 1147555173 17:41474160-41474182 AAGGATGACCAGATACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147555171 Original CRISPR GACACTAAAAAGCTGATAGA AGG (reversed) Intergenic
No off target data available for this crispr