ID: 1147555172

View in Genome Browser
Species Human (GRCh38)
Location 17:41474141-41474163
Sequence CGTCATAAAATATAAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147555171_1147555172 1 Left 1147555171 17:41474117-41474139 CCTTCTATCAGCTTTTTAGTGTC No data
Right 1147555172 17:41474141-41474163 CGTCATAAAATATAAACAAAAGG No data
1147555168_1147555172 16 Left 1147555168 17:41474102-41474124 CCCATCCACGTAGCACCTTCTAT No data
Right 1147555172 17:41474141-41474163 CGTCATAAAATATAAACAAAAGG No data
1147555166_1147555172 24 Left 1147555166 17:41474094-41474116 CCAACCTGCCCATCCACGTAGCA No data
Right 1147555172 17:41474141-41474163 CGTCATAAAATATAAACAAAAGG No data
1147555169_1147555172 15 Left 1147555169 17:41474103-41474125 CCATCCACGTAGCACCTTCTATC No data
Right 1147555172 17:41474141-41474163 CGTCATAAAATATAAACAAAAGG No data
1147555167_1147555172 20 Left 1147555167 17:41474098-41474120 CCTGCCCATCCACGTAGCACCTT No data
Right 1147555172 17:41474141-41474163 CGTCATAAAATATAAACAAAAGG No data
1147555170_1147555172 11 Left 1147555170 17:41474107-41474129 CCACGTAGCACCTTCTATCAGCT No data
Right 1147555172 17:41474141-41474163 CGTCATAAAATATAAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147555172 Original CRISPR CGTCATAAAATATAAACAAA AGG Intergenic
No off target data available for this crispr