ID: 1147555173

View in Genome Browser
Species Human (GRCh38)
Location 17:41474160-41474182
Sequence AAGGATGACCAGATACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147555171_1147555173 20 Left 1147555171 17:41474117-41474139 CCTTCTATCAGCTTTTTAGTGTC No data
Right 1147555173 17:41474160-41474182 AAGGATGACCAGATACTTGAAGG No data
1147555170_1147555173 30 Left 1147555170 17:41474107-41474129 CCACGTAGCACCTTCTATCAGCT No data
Right 1147555173 17:41474160-41474182 AAGGATGACCAGATACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147555173 Original CRISPR AAGGATGACCAGATACTTGA AGG Intergenic
No off target data available for this crispr