ID: 1147555642

View in Genome Browser
Species Human (GRCh38)
Location 17:41477293-41477315
Sequence CAGGATCAAGGTGGTTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147555642_1147555653 6 Left 1147555642 17:41477293-41477315 CCCTAAAAACCACCTTGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1147555653 17:41477322-41477344 TGTTTTACCAAAAGGGAAACAGG 0: 1
1: 0
2: 2
3: 47
4: 356
1147555642_1147555657 22 Left 1147555642 17:41477293-41477315 CCCTAAAAACCACCTTGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1147555657 17:41477338-41477360 AAACAGGCCCTGAGAGGAAAGGG 0: 1
1: 1
2: 9
3: 54
4: 439
1147555642_1147555647 -2 Left 1147555642 17:41477293-41477315 CCCTAAAAACCACCTTGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1147555647 17:41477314-41477336 TGCCCCCTTGTTTTACCAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 115
1147555642_1147555659 24 Left 1147555642 17:41477293-41477315 CCCTAAAAACCACCTTGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1147555659 17:41477340-41477362 ACAGGCCCTGAGAGGAAAGGGGG 0: 1
1: 0
2: 3
3: 50
4: 462
1147555642_1147555648 -1 Left 1147555642 17:41477293-41477315 CCCTAAAAACCACCTTGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1147555648 17:41477315-41477337 GCCCCCTTGTTTTACCAAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 99
1147555642_1147555656 21 Left 1147555642 17:41477293-41477315 CCCTAAAAACCACCTTGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1147555656 17:41477337-41477359 GAAACAGGCCCTGAGAGGAAAGG 0: 1
1: 0
2: 8
3: 49
4: 390
1147555642_1147555655 16 Left 1147555642 17:41477293-41477315 CCCTAAAAACCACCTTGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1147555655 17:41477332-41477354 AAAGGGAAACAGGCCCTGAGAGG 0: 1
1: 0
2: 6
3: 59
4: 524
1147555642_1147555658 23 Left 1147555642 17:41477293-41477315 CCCTAAAAACCACCTTGATCCTG 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1147555658 17:41477339-41477361 AACAGGCCCTGAGAGGAAAGGGG 0: 1
1: 0
2: 7
3: 47
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147555642 Original CRISPR CAGGATCAAGGTGGTTTTTA GGG (reversed) Intronic
900328228 1:2121499-2121521 TAGGATCATGGTGGTACTTAAGG + Intronic
903898999 1:26629238-26629260 CAGGATCATGTTCTTTTTTATGG + Intergenic
910547824 1:88439115-88439137 CAGGATCTAATTTGTTTTTAAGG - Intergenic
913221482 1:116664233-116664255 GAGCATCAAGGTGGCTTTAAAGG - Intronic
917785762 1:178455966-178455988 CAGGATCAAAGTCTTTTTAACGG + Intronic
920741843 1:208588204-208588226 CAGGATCAAGGAGGTTGGAAGGG - Intergenic
924393384 1:243588801-243588823 CAATATCAAGGAGGTTTTTTTGG - Intronic
1063461687 10:6218956-6218978 CAGAAACCAGGTGGATTTTAGGG - Intronic
1063803823 10:9614132-9614154 CTGGATCAAGGTGGGATATATGG + Intergenic
1064848157 10:19679650-19679672 CAAGATCAAGGTGGAATTGAAGG - Intronic
1066120888 10:32286062-32286084 TAGTATCAAGGTGCTTTTTCAGG - Intronic
1067072568 10:43145801-43145823 CAAGGTCAAGGTTGTTTTAATGG + Intronic
1067473448 10:46551722-46551744 CAGGTCCAGGGTGGTCTTTATGG - Intronic
1067727649 10:48782905-48782927 CAGGAGCAAGGTGGGTTGGAGGG + Intronic
1068071722 10:52204823-52204845 CAGGATAACAGTGGTTTTCAGGG + Intronic
1068809879 10:61243518-61243540 CAGGATCCATTTGGTTTTCACGG + Intergenic
1069560003 10:69422678-69422700 CAAGATCAAGTTGCTTTTCAGGG - Intergenic
1070667078 10:78352772-78352794 CAGGATGAAGGTGCTGTTTGGGG - Intergenic
1071995044 10:91139454-91139476 CATGATCTTGGTGGTTTTAATGG - Intergenic
1073163203 10:101419391-101419413 CATAATCAAGGTGGTGTCTAGGG + Intronic
1086122886 11:83318604-83318626 GAACAGCAAGGTGGTTTTTAAGG + Intergenic
1086907531 11:92434513-92434535 CAGGATGAAAGTGGGATTTAGGG + Intronic
1089437679 11:118484293-118484315 CAGGATCAGAGTGGACTTTAAGG + Exonic
1091406409 12:212314-212336 CAGGACCAAGGTGGTCTCAAGGG + Intronic
1093701775 12:22229704-22229726 CAGGATCAAGGATGGTTTGATGG + Intronic
1095854526 12:46845346-46845368 CAGGCTCAAGTGGGTTTTCAAGG + Intergenic
1098641986 12:72850112-72850134 CAGCATCTAGATGGTATTTAAGG + Intergenic
1100218867 12:92482342-92482364 CAGGGTCTTGGTAGTTTTTAAGG - Intergenic
1101644773 12:106621016-106621038 CAGAATAACGGTGATTTTTAGGG - Intronic
1104252085 12:127104788-127104810 CTGGCTCAAGGTCATTTTTATGG - Intergenic
1108017908 13:46095441-46095463 CAGGATCCATCTGGTTTTTGTGG - Intronic
1110759761 13:79218670-79218692 CACTTTCAAGGTGGTATTTATGG + Intergenic
1111304387 13:86388011-86388033 CAAGACAAAGGTGGTGTTTATGG + Intergenic
1116373765 14:44170819-44170841 TAGAGTCATGGTGGTTTTTAAGG - Intergenic
1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG + Intronic
1123767370 15:23494965-23494987 CAGGATCTAGTTCTTTTTTATGG - Intergenic
1124790618 15:32722630-32722652 CAGGATAGAGGTGGTTAATATGG + Intronic
1129740210 15:77986349-77986371 CAGGACCAATGAGGTTTTCAAGG + Intronic
1129845542 15:78766253-78766275 CAGGACCAATGAGGTTTTCAAGG - Exonic
1130767512 15:86886658-86886680 CATGATCATGGATGTTTTTATGG + Intronic
1131601112 15:93850002-93850024 CAGGATCAATGTGGTTAATATGG + Intergenic
1136089543 16:27908586-27908608 CAAGAACAAGGTGGCTTTTCTGG + Intronic
1136999215 16:35214838-35214860 CAGCAGCAAGGTGGTTTTAATGG - Intergenic
1137003738 16:35253313-35253335 CAGCAGCAAGGTGTTTTTAATGG + Intergenic
1137458771 16:48638819-48638841 CTGGATTAAGGTCGTTTTTTTGG - Intergenic
1141780541 16:86157531-86157553 CTGGATGAAGGTGGTTTCTGGGG - Intergenic
1144137318 17:12309256-12309278 CAAGATCTATTTGGTTTTTATGG + Intergenic
1147555642 17:41477293-41477315 CAGGATCAAGGTGGTTTTTAGGG - Intronic
1148451736 17:47782933-47782955 CAGGATGGGGGTGGTTTTGAAGG + Intergenic
1149786654 17:59441214-59441236 AATGACCAAGGTTGTTTTTAAGG + Intergenic
1154958496 18:21283833-21283855 CAGGATCAACTTGGTTCCTAAGG + Intronic
1155276070 18:24188645-24188667 CAAGGTCCAGGTTGTTTTTATGG - Intronic
1156062171 18:33092038-33092060 AAGGATCAATTTGGTTTTCATGG + Intronic
1156731678 18:40201649-40201671 CAAGACCAAGGTGATTCTTAAGG + Intergenic
1157307145 18:46525511-46525533 CAGGCTCAAGGGGGTTTTGTGGG + Intronic
1157585590 18:48799136-48799158 CAGGATCAAGCCAGATTTTAAGG + Intronic
1158479105 18:57804646-57804668 CATGATCAAGGTTGTGTTTTAGG + Intergenic
1160679721 19:407170-407192 CAGGATCAAGGTGGTGAACAAGG - Exonic
1162582929 19:11541259-11541281 CAGGATCATGGTTGTTTTGGGGG - Intronic
925045758 2:771873-771895 CAGGGTCAGGGTGGCTTTTCTGG + Intergenic
927300851 2:21512558-21512580 CAGCAACAAGGTGGTTTGAAGGG - Intergenic
928705202 2:33941949-33941971 CAGGATCTAGTTCTTTTTTATGG - Intergenic
933897797 2:86826569-86826591 CAGGATTAAGATGGTCGTTAGGG - Intronic
935291277 2:101612927-101612949 CAGCATCAAGGAATTTTTTAAGG + Intergenic
942641699 2:178067271-178067293 CATGATCAAAGTGGTGTTTTGGG - Intronic
942748374 2:179262231-179262253 CAGGTACAAGGTTCTTTTTAGGG + Intronic
945570409 2:211460061-211460083 CATGAAAAAGGTGGTTATTATGG - Intronic
948302460 2:236918037-236918059 CAGGATGAAAGTGGGTTCTAAGG - Intergenic
948713692 2:239843714-239843736 CAGGCTTTTGGTGGTTTTTAGGG + Intergenic
1168734891 20:125345-125367 CAGGATCCACGTGGCATTTAAGG + Intergenic
1170078108 20:12442715-12442737 CATGATGTATGTGGTTTTTAAGG - Intergenic
1172927630 20:38553165-38553187 CAGGTTCAAGTTTGTTTTCATGG + Intronic
1173414302 20:42842206-42842228 CAGGTTGGAAGTGGTTTTTATGG + Intronic
1173577090 20:44119548-44119570 CTGGAACAAGGTGGCTTCTATGG - Intronic
1173798191 20:45877389-45877411 CAAGGTCAAGGTGGTCTTTGTGG + Exonic
1175419978 20:58825388-58825410 CAGGATCAAGGAGGTGCTCAGGG + Intergenic
1176513250 21:7764347-7764369 ACGGATCAAGGTGGCTTTCAAGG - Intronic
1178489908 21:33042963-33042985 CAGGATCAAGCTGCGTTTGAAGG + Intergenic
1178633864 21:34285637-34285659 CATGATCAGGGTCTTTTTTAGGG - Intergenic
1178647363 21:34394871-34394893 ACGGATCAAGGTGGCTTTCAAGG - Intronic
1184445460 22:44544510-44544532 CAGGATCAAGGTAGTGATGAGGG + Intergenic
951692149 3:25407777-25407799 GAGGATCAAGGTTGTTCTCATGG - Intronic
952187658 3:30988049-30988071 TAGTTTCATGGTGGTTTTTAAGG - Intergenic
952818867 3:37468634-37468656 CAAGATGAAGGTGGCTTTCAGGG + Intronic
953846531 3:46431819-46431841 CAGAATAACGGTGATTTTTATGG + Intergenic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
963333825 3:143948445-143948467 CAGCATCAAGGTTGACTTTAAGG + Intergenic
964893973 3:161571864-161571886 AAGCATCAATGTGGTGTTTAAGG + Intergenic
970961544 4:21877422-21877444 TAGGACCAAGGTTGGTTTTATGG + Intronic
974647748 4:64716419-64716441 CAGGGTCAAGGTGGCTGTTTGGG + Intergenic
974694590 4:65349307-65349329 CATTATCAAGTTGTTTTTTATGG + Intronic
978033219 4:103961722-103961744 CAGGATCCAAGGGCTTTTTAAGG - Intergenic
978916780 4:114135326-114135348 CAGGACCCAGGTGGTTTTAATGG + Intergenic
979340741 4:119520544-119520566 CAGGAACTAGGTGGTTTTTGAGG + Intronic
979428039 4:120592244-120592266 CAGAATAAAAGTGGTATTTAAGG - Intergenic
979755221 4:124332023-124332045 CAGGAGCCATGTGGTTCTTATGG - Intergenic
982024924 4:151242516-151242538 CATGATCCAGGTGGCTTTTCAGG + Intronic
986514517 5:8547341-8547363 TAGTATCAAAGTGGTATTTAAGG - Intergenic
986581150 5:9267066-9267088 CAGAATCAAGGTGGATTTCTAGG + Intronic
987158089 5:15111332-15111354 CAGGAACAAGGTGAAGTTTAAGG + Intergenic
987457913 5:18169813-18169835 GAGCACCAAGGAGGTTTTTAGGG + Intergenic
988564590 5:32311449-32311471 CAGGCCCCAGGTGGTCTTTACGG + Intronic
996826105 5:127683100-127683122 CAGGATCAAGATGCTTTGCAAGG + Intergenic
996929732 5:128871337-128871359 CAGTGTCAGTGTGGTTTTTATGG - Intronic
997272647 5:132554854-132554876 CAGAATTCAGGTCGTTTTTAAGG - Intronic
997654582 5:135545591-135545613 CAGGGACAATCTGGTTTTTAAGG + Intergenic
1003505888 6:6740095-6740117 CAGGTTCAATGTGGGTTTGAAGG + Intergenic
1004267929 6:14165530-14165552 CAGGAACAGGGTGGTTATGATGG - Intergenic
1004488877 6:16094792-16094814 TGGGACCAAGGTGGTTTTTCTGG - Intergenic
1008883358 6:56405155-56405177 CAAAATCAATGTTGTTTTTAAGG - Intergenic
1010787050 6:80015906-80015928 GAGGATCAAGGAGGTTATTGAGG - Intronic
1014880581 6:126719165-126719187 CAGGGTTAAGGTCATTTTTAGGG - Intergenic
1022604487 7:31796642-31796664 AAGGAACAAGGTGCTTTTTCAGG + Intronic
1023305792 7:38825612-38825634 CAGGTTCAGGGTAGTTGTTAGGG - Intronic
1023328833 7:39091084-39091106 CAGCATTACGGTGGTTTTTCTGG - Intronic
1024777550 7:52805401-52805423 CTTGATAAAGGTGATTTTTAAGG + Intergenic
1028959881 7:96736751-96736773 CATGATAAAAGTGGTGTTTATGG + Intergenic
1029153178 7:98496074-98496096 ATGGATGAAGGTGGTTTTTCAGG - Intergenic
1029656999 7:101932832-101932854 CAGGATCAGGGTAGGTTCTAGGG + Intronic
1030424826 7:109362245-109362267 CAGGTTCAAGGTTTTATTTAGGG - Intergenic
1036555550 8:9856583-9856605 CAGGATCATGTTCTTTTTTATGG + Intergenic
1041345696 8:56895338-56895360 CAACACCATGGTGGTTTTTATGG + Intergenic
1044086308 8:87946017-87946039 CAGGATCACAGTGATTTTCAGGG - Intergenic
1044379552 8:91518033-91518055 CATGATCATGATGGTCTTTATGG - Intergenic
1045055054 8:98361772-98361794 TAGGAACAAGGTGGTTTTGCTGG + Intergenic
1045066517 8:98451701-98451723 GAGGTTGAAGGTGGTTTGTATGG + Intronic
1045894237 8:107194993-107195015 CAGAATCAAGGAAGTCTTTATGG - Intergenic
1046633124 8:116641533-116641555 CAGGCTCAAGGTGCATTATAGGG + Intergenic
1048033825 8:130657916-130657938 CAGAATCACAGTGATTTTTAGGG - Intergenic
1050503857 9:6327367-6327389 CTGGAACAAATTGGTTTTTAGGG + Intergenic
1051624347 9:19084379-19084401 CAGGTTCAAGGAGGATTCTAGGG + Intronic
1055533293 9:77209868-77209890 CAGGATCAAGGAATTATTTAAGG - Intronic
1056803930 9:89713381-89713403 TAGGACCAAGATGGTTCTTATGG - Intergenic
1057933603 9:99218021-99218043 CAGGCCCATGGTGGCTTTTAAGG + Exonic
1203790383 EBV:148411-148433 CAGGATCACGGAGGTTTACATGG - Intergenic
1186106374 X:6211946-6211968 CAGCCTCAAGGAGGCTTTTAAGG - Intronic
1186229854 X:7441618-7441640 CAGGATGAAAGAGGATTTTAAGG - Intergenic
1187998706 X:24957509-24957531 CACGCTCAAGGTGATGTTTATGG + Intronic
1188831960 X:34909373-34909395 CAGGATCTCATTGGTTTTTATGG + Intergenic
1196193370 X:112816347-112816369 CAAGATGGGGGTGGTTTTTATGG - Intronic
1196320322 X:114280271-114280293 CAGTAGCATGGTGGCTTTTAGGG - Intergenic
1198011612 X:132562276-132562298 CAAGATCAAGGTAAGTTTTAAGG + Intergenic
1199173560 X:144758504-144758526 GAGCATCAAGGGGGCTTTTAGGG + Intergenic
1199473685 X:148222746-148222768 CATGATCTAGGTCTTTTTTATGG + Intergenic