ID: 1147557513

View in Genome Browser
Species Human (GRCh38)
Location 17:41488843-41488865
Sequence CCTGGGGTGTGGCTCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 577}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147557513_1147557528 5 Left 1147557513 17:41488843-41488865 CCAGCCCTGAGCCACACCCCAGG 0: 1
1: 0
2: 4
3: 73
4: 577
Right 1147557528 17:41488871-41488893 GGGGAGCATCCACCCCACAGGGG 0: 1
1: 0
2: 1
3: 21
4: 143
1147557513_1147557530 15 Left 1147557513 17:41488843-41488865 CCAGCCCTGAGCCACACCCCAGG 0: 1
1: 0
2: 4
3: 73
4: 577
Right 1147557530 17:41488881-41488903 CACCCCACAGGGGCATCCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 128
1147557513_1147557527 4 Left 1147557513 17:41488843-41488865 CCAGCCCTGAGCCACACCCCAGG 0: 1
1: 0
2: 4
3: 73
4: 577
Right 1147557527 17:41488870-41488892 GGGGGAGCATCCACCCCACAGGG 0: 1
1: 0
2: 0
3: 27
4: 371
1147557513_1147557526 3 Left 1147557513 17:41488843-41488865 CCAGCCCTGAGCCACACCCCAGG 0: 1
1: 0
2: 4
3: 73
4: 577
Right 1147557526 17:41488869-41488891 GGGGGGAGCATCCACCCCACAGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147557513 Original CRISPR CCTGGGGTGTGGCTCAGGGC TGG (reversed) Intronic
900101258 1:963047-963069 CCTGGGGTGTGGCCCAGCAGTGG + Intronic
900191247 1:1353233-1353255 ACTGGGGTCAGCCTCAGGGCAGG - Exonic
900243220 1:1626514-1626536 CCTGGGGTCGGGGTCGGGGCCGG + Intronic
900254807 1:1692591-1692613 ACTGGGGAGTGGCACAGCGCTGG + Exonic
900263558 1:1745866-1745888 ACTGGGGAGTGGCACAGCGCTGG + Exonic
900392316 1:2439028-2439050 CCTGGGAGCTGGGTCAGGGCTGG - Intronic
900458200 1:2787449-2787471 CCTGGGGGGTGACAGAGGGCAGG - Intronic
900487241 1:2928985-2929007 GCTGCAGTGTGGCTCAGAGCAGG + Intergenic
900749011 1:4382250-4382272 CTCATGGTGTGGCTCAGGGCAGG + Intergenic
900762052 1:4479759-4479781 ACTGGGGTCAGGGTCAGGGCAGG + Intergenic
900772253 1:4554494-4554516 CCTGGGGGGATGCTCAGGCCAGG + Intergenic
900996366 1:6125451-6125473 CCTGGGGTATGGAGGAGGGCTGG - Intronic
901036316 1:6338335-6338357 ACTCGGGAGAGGCTCAGGGCTGG - Intronic
901447877 1:9319243-9319265 CCAGGGGGGTGGCACAGGGAGGG + Intronic
901928878 1:12584110-12584132 CCTGGGGTCTGGCTGAGGTAGGG + Intronic
901988151 1:13092054-13092076 CCTTGGGTGTGAATCAGGGATGG + Intergenic
901993661 1:13134713-13134735 CCTTGGGTGTGAATCAGGGATGG - Intergenic
902577338 1:17386609-17386631 CATGAGGCCTGGCTCAGGGCTGG + Intronic
902896653 1:19484703-19484725 CCTGATGAGAGGCTCAGGGCGGG + Intronic
902919666 1:19658227-19658249 CCTGGGGGGAGGGACAGGGCAGG + Intronic
903322675 1:22552258-22552280 CCTGGGAAGTGGCTCAGATCTGG + Intergenic
903349584 1:22710169-22710191 CCTGGGGTGGGGCTGGGGGGAGG - Intergenic
903732074 1:25503959-25503981 GCTGGGGGGTGGCTTTGGGCAGG - Intergenic
903740699 1:25556879-25556901 TTTGGGGTGTGGCTCAGTGTGGG + Intronic
904339702 1:29826844-29826866 CGTGCTGTGTGGCTTAGGGCAGG - Intergenic
904868750 1:33603009-33603031 CCTGGGGTGAGGCTAAGGTTGGG + Intronic
905371253 1:37483693-37483715 TCTGGGGTGGGCCTCAGGGCTGG - Exonic
906129560 1:43448057-43448079 CCTGGGGTGGGGAGCAGGGCAGG - Exonic
906461182 1:46035884-46035906 ACTTGGGTGATGCTCAGGGCTGG - Exonic
906607594 1:47182714-47182736 CCTGGGGTGGGAGTCAGGGTTGG - Intergenic
907391236 1:54159945-54159967 CTGGGGGTGTGGCAGAGGGCAGG + Intronic
907655761 1:56340548-56340570 CCTGTGGTGTGGGTGTGGGCAGG - Intergenic
907959899 1:59269036-59269058 GCTGGGGTGTGGCTAAGGTGAGG + Intergenic
908419508 1:63946150-63946172 GCTGGTGTGTGGCTCTGGGCAGG + Intronic
910071986 1:83227664-83227686 ACATGGGTGTGGCTCATGGCAGG - Intergenic
912490121 1:110058124-110058146 TCTGGAGTGAGGCTGAGGGCAGG + Intronic
912505402 1:110152330-110152352 CCTGGAGGGTGACTCAGTGCAGG + Intronic
912690052 1:111798107-111798129 CTTGGGGTGAGGCTCAGGCTTGG + Intronic
912993043 1:114508607-114508629 GCTGGGGTGAGGGTGAGGGCTGG - Intronic
913200303 1:116490760-116490782 CCTGGGGTGAGGCTAAGAGGTGG - Intergenic
916210672 1:162357197-162357219 CCTAGCGAGGGGCTCAGGGCAGG + Intronic
916741623 1:167651399-167651421 TCTAGGATGTGGCCCAGGGCAGG - Intronic
918184205 1:182112750-182112772 CCTGTGGAGTGGCTCATGGGTGG + Intergenic
918522039 1:185425231-185425253 GCTGGGTAGAGGCTCAGGGCTGG - Intergenic
919737228 1:200960280-200960302 GCTGGGGAGTGGCACTGGGCAGG - Intergenic
919796804 1:201325745-201325767 CCTTGGGTGAGGCACTGGGCAGG - Exonic
920046311 1:203135006-203135028 GGTGGGGTGGGGCTCAGGGAAGG - Intronic
920530177 1:206696016-206696038 CCCGGGATGTGGCCCAGAGCTGG - Intronic
921213813 1:212920904-212920926 CTTTGGGTCTGGCTCCGGGCTGG + Intergenic
922153300 1:223022843-223022865 CCTGGCCTGTGGCTTAGGCCTGG + Intergenic
922883999 1:229003998-229004020 CTTGGTGTCTGGCTCAGGGTTGG + Intergenic
924150286 1:241123149-241123171 CCTGGGGTCTGCAGCAGGGCAGG - Intronic
924741161 1:246794987-246795009 CCTGGGGGGTGGAGCAGGGTGGG - Intergenic
1062834550 10:627167-627189 CCTGGTGTGTGGGGCAGGCCTGG - Intronic
1063127967 10:3152202-3152224 CATGGGCTGTGGCTCAGTGGAGG - Intronic
1063601346 10:7483766-7483788 CGTGGGGAGTGGCTCAGGTCAGG - Intergenic
1064271755 10:13871866-13871888 CCGGCGGTGTGGCTCAGGGAGGG - Intronic
1067148757 10:43712308-43712330 CCTGGGGCTGGGCTCAGGGTGGG + Intergenic
1069807229 10:71133616-71133638 CCCCTGGTGTGGCTCAGGGAAGG - Intergenic
1070305751 10:75238229-75238251 TCTGGGGTGAGGCTACGGGCCGG + Intergenic
1070532616 10:77350383-77350405 CCTGGGGTGTAGACCAGAGCAGG + Intronic
1070557816 10:77542750-77542772 CCTGGGGTGAGGGTGGGGGCAGG + Intronic
1070798368 10:79230365-79230387 CTGGGGGCGTGGCCCAGGGCTGG - Intronic
1070826227 10:79391926-79391948 TCTAGGGTGTGGCTGAGGGGTGG - Intronic
1071110192 10:82146824-82146846 CCTGGGGTGTGGTACAGGGAGGG + Intronic
1071563018 10:86657731-86657753 CCTGAGGCGTGGCCCAGCGCAGG - Intronic
1074563941 10:114559560-114559582 CCTGGGGTCTCCCTCGGGGCAGG + Intronic
1075094210 10:119460592-119460614 GCTGGAGTGTGGCTCCAGGCAGG - Intergenic
1075669922 10:124257188-124257210 CCTGGGGAGGGGCTCAGGGAGGG + Intergenic
1075711617 10:124533818-124533840 CTTGGGGTCTGGCCCTGGGCTGG - Intronic
1075834766 10:125444151-125444173 CCATGGGTCTGGCACAGGGCAGG + Intergenic
1076326847 10:129630387-129630409 TCTTTGGTGTGGCTCATGGCTGG + Intronic
1076571733 10:131437755-131437777 CCTGGGGAGTGGCCCAGGGAGGG - Intergenic
1076606976 10:131695490-131695512 CCAGGGCTGAGGCTCAGGGCGGG + Intergenic
1076672871 10:132132783-132132805 CCTGGGGAGTGGGCCTGGGCTGG + Intronic
1076710197 10:132329119-132329141 CCCGGGCAGTGGCTCAGGACTGG + Intronic
1076745366 10:132510183-132510205 TCTGGGGAGGGGCCCAGGGCAGG - Intergenic
1076802431 10:132836714-132836736 CCTGGGGTGGGGCTGAGGTGTGG + Intronic
1076826403 10:132971814-132971836 CCTGGGGGGAGGTTCAGAGCAGG + Intergenic
1077060296 11:614984-615006 CCTGGGCTGTGGCCCGCGGCAGG - Exonic
1077167180 11:1148945-1148967 CTAGGGGCGTGGCTCAGAGCAGG + Intergenic
1077363902 11:2153784-2153806 CCGTGGGTGTGGTTCAGGTCTGG - Intronic
1077890562 11:6415194-6415216 ACTGGGTTCTGGCTCAAGGCAGG + Intronic
1078007030 11:7539855-7539877 GCTTGGCTGTTGCTCAGGGCAGG + Intronic
1078429758 11:11280117-11280139 CCTGGGGTGTGGGGCACAGCAGG - Intronic
1078464987 11:11543567-11543589 CCAGGGGTGTGGGGAAGGGCAGG + Intronic
1078495984 11:11817712-11817734 CCTCTGGCGTGGCTCAGTGCAGG - Intergenic
1078720050 11:13875901-13875923 CCAGAGGTCAGGCTCAGGGCAGG + Intergenic
1079007106 11:16799835-16799857 CCTCGCCTGTGGCTCAGGGCTGG - Intronic
1081599911 11:44485822-44485844 TCCGAGGTGTGGCCCAGGGCAGG - Intergenic
1081607366 11:44535712-44535734 CCTGGGCTGGGGCTGAAGGCTGG + Intergenic
1081676779 11:44974571-44974593 CCTGGAGTCTGGCTCAGCCCTGG - Intergenic
1081733476 11:45387537-45387559 CCTGGGAGGTGGCACAAGGCAGG - Intergenic
1082763877 11:57151143-57151165 CAAGGGGTGTGGCTCTGAGCTGG - Intergenic
1083276475 11:61599836-61599858 GTTGGGGGCTGGCTCAGGGCAGG - Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083593789 11:63909660-63909682 CCGGGAGGGTGGCTCAGGGCTGG + Exonic
1083658215 11:64240499-64240521 CCTGGGCTGTGACTCATGACTGG - Intergenic
1083661431 11:64253182-64253204 AATGGGGTGTGGCTGAGGCCAGG + Intronic
1084045930 11:66567857-66567879 CCTGGGAAGTGGCTCAAGGTGGG + Intronic
1084546241 11:69816491-69816513 CCCGGGGTGTGGCTTTGGGCAGG - Intronic
1084797576 11:71518879-71518901 CCGTGGGGGTGGCACAGGGCAGG + Intronic
1084917986 11:72445174-72445196 TCAGGGGTGTGGCTTAGGTCAGG + Intergenic
1084950939 11:72665194-72665216 CCTGGGGTTGGGGTCTGGGCAGG - Intronic
1085457886 11:76675529-76675551 TCTGCGGTGGGGCTCGGGGCAGG + Intergenic
1085511564 11:77090839-77090861 TGTGGGGTGTGGTCCAGGGCTGG + Intronic
1085735701 11:79037090-79037112 TCTGGGGTGAGGATGAGGGCAGG + Intronic
1085954012 11:81368499-81368521 GCTGGGGTGTGGCTCAGGCATGG + Intergenic
1086129883 11:83390170-83390192 CCTGAGGAGTGGCTAAGGGATGG + Intergenic
1086165572 11:83774104-83774126 CCTGGGGTCTGGCAGAGGGATGG - Intronic
1088469760 11:110179335-110179357 GCTGGGTGGTGGCTCTGGGCTGG - Intronic
1088699966 11:112403007-112403029 CTTGGGGTGAGTCTCAGGACAGG + Intergenic
1089620284 11:119718214-119718236 CCAGGGTTGTGGCTGAGGACTGG - Intronic
1090236451 11:125151890-125151912 CCTGGGGTCAGGCTCCTGGCTGG - Intergenic
1090238663 11:125166663-125166685 TCTGGGCTGTGGCCCAGGGTAGG + Intronic
1091723658 12:2830963-2830985 CCTAGGGTAAGGCTCAGGGCTGG - Intronic
1092609093 12:10153466-10153488 CCTGTGGTGTGGCCCAGCGCGGG + Intergenic
1094317639 12:29149935-29149957 CCTGGGGTGGGGCTGGGGGCTGG - Intronic
1095048192 12:37533417-37533439 CCTGGGGTCTGGCCCTGGGTTGG - Intergenic
1096578228 12:52568113-52568135 ACTGGGGTGTGGCTCCTGTCTGG - Intronic
1096971516 12:55670338-55670360 AATGGGGTGAGGCTCAGGGTTGG - Intergenic
1097183442 12:57183935-57183957 CTTGGGGTGTGGCAGAGGACTGG + Intronic
1097392371 12:59031371-59031393 GCTGGGGTTTGGCTCCAGGCTGG + Intergenic
1097976911 12:65696345-65696367 CCTGGAGTATTCCTCAGGGCAGG + Intergenic
1099485545 12:83225174-83225196 CCTGGGCTGTGCCTCAGGTCTGG + Intergenic
1100318756 12:93469888-93469910 CTTGGGATTTGGCTGAGGGCAGG + Intronic
1101286298 12:103316754-103316776 CTTGGGATATGGCTCAGAGCTGG - Intronic
1102299778 12:111762846-111762868 CGTGGTGTGTGTCTCAGTGCAGG - Intronic
1103212095 12:119174677-119174699 CCTGGGGAGGGGCTGGGGGCTGG + Intergenic
1103509890 12:121467127-121467149 CCCGGGGTGGGGCTGAGGGAGGG - Intronic
1104313561 12:127676206-127676228 CCTGGGCTGTGGCTCTGTGACGG - Intergenic
1104466326 12:128993832-128993854 GCTGGGGAGTGGCGCAGGCCTGG - Intergenic
1104839720 12:131817336-131817358 CCTGGCGTGGGGCTCAGGCTTGG + Intergenic
1104919372 12:132282729-132282751 CCTAGGGGTTGGCTCAGGGCTGG - Intronic
1105209213 13:18247928-18247950 CCTGAGATGTGGCCCCGGGCTGG + Intergenic
1106418375 13:29565358-29565380 CCTGGGGAGTACTTCAGGGCAGG + Intronic
1106590752 13:31096741-31096763 CCTCGGGTGTGGCTCCGGGCGGG + Intergenic
1108559454 13:51628189-51628211 CCTGAGGGGCGGCTCAGCGCAGG - Intronic
1108752602 13:53463696-53463718 AGTGGGCTGTGGCTGAGGGCAGG - Intergenic
1110318192 13:74134274-74134296 CCCGGGGTGGGGCCGAGGGCGGG + Intergenic
1110731660 13:78885517-78885539 CCTGGGGTGTTTCTGATGGCTGG - Intergenic
1112180067 13:97069679-97069701 CCTTTGGTGAGGCTGAGGGCTGG - Intergenic
1112501743 13:99948223-99948245 GCAGGAGTGTGGCTGAGGGCTGG + Intergenic
1113940327 13:114015416-114015438 CGTGGGGAGGGGCTGAGGGCGGG + Intronic
1114190378 14:20435947-20435969 GCTGGGATGTGGCTGAGGGTAGG - Intergenic
1115271836 14:31561470-31561492 GGTGGGGTGTCGCTCCGGGCTGG + Exonic
1115961275 14:38837803-38837825 CCTGGGAAATGGCTCAGGGATGG - Intergenic
1115973722 14:38974031-38974053 CCCGGGGTGTAGGTCAGAGCTGG - Intergenic
1116870162 14:50062494-50062516 CCTGGGTTGGGGCTCAGGCCGGG - Intergenic
1119184675 14:72631591-72631613 GCTGGGGTGTGGCACAGAACTGG - Intronic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119410592 14:74427558-74427580 CCTGGGGTCTGTCTCAGGGCTGG + Intergenic
1120266715 14:82260013-82260035 TCTGGGGTGTGGCCCAGGCTTGG + Intergenic
1121043987 14:90774692-90774714 CCTGGAGTGCGGCTTAGGGAAGG - Intronic
1121266959 14:92610461-92610483 CATGGTGTTGGGCTCAGGGCAGG + Intronic
1121278885 14:92686143-92686165 CCAGGAGTGTGGCTCAGGACTGG - Intronic
1122834254 14:104423407-104423429 CCTGGGGAGGGGCTCTGGGCAGG - Intergenic
1122845675 14:104496828-104496850 CCTGGAGTATGGAGCAGGGCAGG - Intronic
1122855109 14:104556406-104556428 CCTGGGGTGAGGGGCAGGGCTGG - Intronic
1122857998 14:104569090-104569112 GCTGAGGTGTGGCTAGGGGCAGG - Intronic
1122968819 14:105144172-105144194 CCTGGGGTGTGGCCCATAGGTGG - Intronic
1123113493 14:105883550-105883572 CCTGGGCTGTGGGACGGGGCAGG + Intergenic
1123173716 14:106398753-106398775 CCTGGCGCGGGGCTCAGGCCTGG - Intergenic
1123687366 15:22808431-22808453 GGTAGGGCGTGGCTCAGGGCTGG + Intronic
1124642011 15:31401591-31401613 CCTGGTGTGTGGGGCTGGGCTGG + Intronic
1125771845 15:42173251-42173273 CCTGGGGTCTGCCTGAGGTCTGG - Intronic
1126163511 15:45634916-45634938 CCTGGGCTGCGGCGCCGGGCGGG + Exonic
1126507572 15:49424437-49424459 TCTTGTGTGTCGCTCAGGGCTGG - Exonic
1128262160 15:66240078-66240100 GCTGGGGTGGAGCTCAGGGCAGG - Intronic
1128349903 15:66881731-66881753 CCAGGGGCAAGGCTCAGGGCAGG - Intergenic
1129034009 15:72639042-72639064 CCTGGGGACTGGCTCAAAGCAGG - Intergenic
1129150192 15:73683803-73683825 TCTGGGGTGGGGCTGGGGGCAGG + Intergenic
1129215873 15:74098174-74098196 CCTGGGGACTGGCTCAAAGCAGG + Intergenic
1129385766 15:75195559-75195581 GCTTGGCTCTGGCTCAGGGCTGG - Intergenic
1129408929 15:75338281-75338303 CCTGGGGACTGGCTCAGAGCAGG - Intronic
1129606543 15:77027979-77028001 CCTGGGCTGTGGCCCCGGGCAGG + Intronic
1129733015 15:77942505-77942527 CCTGGGGACTGGCTCAGAGCAGG + Intergenic
1129879559 15:78997921-78997943 CTTGGGGGCAGGCTCAGGGCTGG - Intronic
1130025479 15:80267302-80267324 CCTTGTGTGTGGGTCAGGACGGG + Intergenic
1130228155 15:82075739-82075761 CCTGGAGAAGGGCTCAGGGCTGG + Intergenic
1130334175 15:82944639-82944661 CACGGGGTGGGGCTGAGGGCAGG - Intronic
1130653673 15:85777047-85777069 GCTGGGGTGAGGCTGAGGGCTGG - Intronic
1131059918 15:89398279-89398301 CCTGGTGTGGGGCTCTGGGAAGG + Intergenic
1131234422 15:90683560-90683582 CCATGGGTGTGGCTGGGGGCGGG + Intergenic
1132178470 15:99733554-99733576 CCCGGGGCGGGGCTCGGGGCGGG + Intronic
1132331138 15:101013181-101013203 CCTGAGGTCTGGCACATGGCAGG + Intronic
1132618285 16:852887-852909 CCTGAGCTGTGCCACAGGGCTGG + Intergenic
1132696955 16:1206312-1206334 CCTGGGGTGAGACACTGGGCGGG - Intronic
1132728345 16:1348501-1348523 CTTGGGGTGGGGGCCAGGGCCGG - Exonic
1132901242 16:2255659-2255681 CCTGGGGGGTGGCCTAGGCCAGG + Exonic
1132997335 16:2830165-2830187 CCTGGGGGAAGGCCCAGGGCCGG - Exonic
1133036351 16:3036241-3036263 CCTGGCGTGGGGCCCAGGACAGG + Intronic
1133054165 16:3137255-3137277 CCTGGCCTGAGGCTCAGGGTTGG - Exonic
1133352746 16:5112979-5113001 GGTGGGGTGTGGCTCTGGCCTGG + Intergenic
1133847018 16:9464551-9464573 CCTGTGGTCTGACTCATGGCAGG - Intergenic
1134274321 16:12762139-12762161 CCTGGGGTCTGCCCAAGGGCAGG + Intronic
1135016254 16:18926734-18926756 CCTGCGGTGTGGGTGGGGGCTGG + Intergenic
1135062294 16:19281179-19281201 GCTGGAGTGTGGCTCAAAGCTGG + Intergenic
1135404041 16:22185404-22185426 CATCGGCCGTGGCTCAGGGCCGG - Intronic
1135995493 16:27244678-27244700 CCTGGGGTGTGGCTTTGGCCAGG - Intronic
1136089859 16:27911057-27911079 CCTTGACTGGGGCTCAGGGCAGG - Intronic
1136374925 16:29859727-29859749 CCAGGCGTGTGGCTCATGCCTGG + Intronic
1136413164 16:30088867-30088889 CCAAGGGTGAGGCGCAGGGCAGG - Intronic
1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG + Intergenic
1137623037 16:49889160-49889182 CCTGCGGTGGGGCTTGGGGCTGG + Intergenic
1137832268 16:51555085-51555107 TCTGGGGTGTGACTCATGGGAGG + Intergenic
1138535269 16:57656634-57656656 CCTGGGGTGTGGCTGCGAGGTGG - Intronic
1138583957 16:57958595-57958617 CCTGGGCTCTGGCTCCTGGCAGG - Intronic
1139373292 16:66481385-66481407 CCTGGGGTAGGGGTCAGGGCAGG - Exonic
1139406317 16:66720992-66721014 CCAGGGGTGTGGCTCTGTCCGGG - Exonic
1139428986 16:66901023-66901045 TCTGGGGTGAGCCTGAGGGCAGG + Intergenic
1141461036 16:84179062-84179084 CCTGGGGTGTCCCTCTGGGGTGG + Exonic
1141640404 16:85337701-85337723 CCATGGGTGTGGGCCAGGGCCGG + Intergenic
1141979899 16:87543591-87543613 CCAGGGGTGTAGCACTGGGCAGG + Intergenic
1142247986 16:88978498-88978520 CCTGTGCTCTGGCTCAGGGTGGG + Intergenic
1142376985 16:89711560-89711582 CCTCGGGTGTGGGTGGGGGCGGG - Intronic
1142765715 17:2063108-2063130 CCTGGTTTGAGGCCCAGGGCAGG - Intronic
1143013989 17:3882048-3882070 CCTTGTGTCTGGTTCAGGGCTGG - Intronic
1143376467 17:6470442-6470464 CCTCGGGTGAGGCCCCGGGCCGG - Intronic
1143467324 17:7146200-7146222 GCTGGTGGGTGGCTCTGGGCGGG - Intergenic
1143476179 17:7205044-7205066 CGTGGGGCGGGGCCCAGGGCAGG - Intronic
1143684570 17:8503763-8503785 CCTGGGGAGTTGCTGAGGCCTGG - Intronic
1144457801 17:15433172-15433194 CCTGGGCTGAAGCTAAGGGCTGG - Intergenic
1144847961 17:18229863-18229885 CTTGGGGTGGGCCTCAGGGTGGG + Intronic
1144848121 17:18230579-18230601 CCTGGGGTGGGGGTGGGGGCAGG + Intronic
1144871863 17:18376868-18376890 CCTGGGCTCTGGCTGAGGCCCGG - Intergenic
1145269241 17:21395945-21395967 CCTGCTGTGTGGCTCAGGCATGG + Intronic
1145411458 17:22669599-22669621 GCGGGGGTCTGGCCCAGGGCTGG - Intergenic
1146059047 17:29594924-29594946 CCTGGGGGCTGGCTCAGCGTGGG - Intronic
1147213209 17:38884197-38884219 CCTGGAGTGTGGCTGATGGCAGG + Intronic
1147389439 17:40100170-40100192 CCTGGGCACTGGCTAAGGGCGGG + Exonic
1147557513 17:41488843-41488865 CCTGGGGTGTGGCTCAGGGCTGG - Intronic
1147583341 17:41638827-41638849 CCTCGGATGAGGCCCAGGGCGGG + Intergenic
1147668826 17:42165176-42165198 TCTGGGGTGGGGCTGAGGGGTGG + Intronic
1149423182 17:56530442-56530464 CCTGGGCTGTTTCTCAAGGCAGG - Intergenic
1149614813 17:57988433-57988455 GCTGGGGTGGGGCCCGGGGCGGG + Intergenic
1150265956 17:63832585-63832607 CCTGGGGCGAGGGTCAGAGCTGG - Exonic
1150706746 17:67493984-67494006 CCTGGGGACTGGCACATGGCAGG - Intronic
1150810022 17:68348856-68348878 CCTGGGCTGTTCCTCAGGTCAGG + Intronic
1151536322 17:74740915-74740937 CCAGGGCTGTGGCTCAGGCATGG + Intronic
1151577874 17:74962052-74962074 CCTGGGCTGGGGCGCTGGGCTGG - Intronic
1151658534 17:75506945-75506967 ACAGGGGCGTGGCGCAGGGCAGG - Intronic
1151719741 17:75848179-75848201 CCGGGAGGGAGGCTCAGGGCTGG + Intronic
1151749428 17:76028198-76028220 CCTGGGCTCTGGCTGAGGCCCGG + Intergenic
1151871510 17:76840169-76840191 CCAGGTGACTGGCTCAGGGCAGG - Intergenic
1152217352 17:79041499-79041521 CCTGGGCCGTGGCTCACGCCTGG + Intronic
1152235287 17:79135404-79135426 GGTGGGGTATGGCTCAGGGCAGG - Intronic
1152413557 17:80144140-80144162 CCTGGGGTGCGGCGCAGGGCTGG - Intronic
1152429819 17:80242540-80242562 CCTGGAGGGAGGCACAGGGCAGG - Intronic
1152587685 17:81196318-81196340 CCTGGGGTCTGGCCTGGGGCCGG - Intronic
1152816349 17:82410299-82410321 CCTGGGGAGAATCTCAGGGCAGG + Intronic
1152858143 17:82677859-82677881 TCTGGGCTGTGGCTGAGGGATGG - Intronic
1152888807 17:82868177-82868199 CCTTGGGTGCAGCTCAGGGCCGG - Intronic
1154412370 18:14148339-14148361 CCCTGGGTGTGGCACAGGACAGG + Intergenic
1155155178 18:23151607-23151629 CCTGGGGTGAGTCACAGAGCGGG + Intronic
1155923122 18:31625414-31625436 ACAGGGGTGTGTCTCAGAGCAGG + Exonic
1156230080 18:35145040-35145062 CATGGGGTCTGGCTCAGAGTTGG - Intergenic
1157292367 18:46419304-46419326 CCTGAGGTCTGGCCTAGGGCTGG - Intronic
1157580380 18:48770850-48770872 CGAGTGGTGTGGCTCAGAGCTGG - Intronic
1157716823 18:49893705-49893727 CCTGGGGTCTGGGTGAAGGCAGG + Intronic
1157752831 18:50194336-50194358 CCTGGGGTGGGGTCCACGGCGGG + Intronic
1157823546 18:50791678-50791700 CCTGTGGTGTGGCCAATGGCAGG - Intergenic
1158118819 18:54026052-54026074 CCTGGGGTGTGACTGGGGGTGGG - Intergenic
1158205250 18:54985549-54985571 CATGGGGAGTGCCTCAGGGGAGG - Intergenic
1158545492 18:58392782-58392804 CCTGGGGCTTGGCTCAACGCTGG - Intronic
1158606196 18:58898562-58898584 TCCGGGGCCTGGCTCAGGGCTGG - Intronic
1160396973 18:78579917-78579939 CCTGGGGTGTGCATCAAGGAAGG - Intergenic
1160575126 18:79848845-79848867 CCTGAGGAGTGGCCCCGGGCAGG + Intergenic
1160583726 18:79901460-79901482 ACAGGGCTGGGGCTCAGGGCAGG + Intergenic
1160613606 18:80108166-80108188 GCTGGAGTGGGCCTCAGGGCTGG + Intergenic
1160710680 19:549647-549669 CCTGGTGTGTGGCAAAGGCCGGG + Exonic
1160812059 19:1017212-1017234 CTGGGCGTGTGGCTCAGGGCCGG - Intronic
1160831129 19:1105292-1105314 CCTGGGGTGGGGCGCGGGGTCGG + Intronic
1160838843 19:1137262-1137284 GCTGGGGTGAGGCTCGGGCCGGG + Intronic
1160869405 19:1270185-1270207 CCTGGGGGGCACCTCAGGGCAGG - Intronic
1160873801 19:1288169-1288191 CCTGCAGTGGGGCCCAGGGCTGG + Intronic
1160913765 19:1487350-1487372 GCTGGGGTGTGGGGAAGGGCAGG - Intronic
1161027483 19:2043197-2043219 CCTGGGGTGGGGGTGGGGGCAGG + Exonic
1161067340 19:2245285-2245307 CCTGGGGTTTGGCTGAGGACAGG - Intronic
1161091276 19:2361164-2361186 TCTGGGGTGTGGTGCGGGGCTGG + Intergenic
1161220719 19:3116882-3116904 CCTGGGGTGGGTCTCAAGGCAGG - Intronic
1161226711 19:3150315-3150337 CGTGGGGAGGGGCTGAGGGCAGG + Intronic
1161265038 19:3360005-3360027 CCTGGGGTCTGGCCCGGGGAGGG - Intronic
1161301251 19:3544160-3544182 CCTGCGGGGGGGCTCTGGGCAGG - Intronic
1161824255 19:6551801-6551823 CCTGGGCTGGCGCCCAGGGCAGG + Intergenic
1161943615 19:7420795-7420817 CGACGGGTGTGACTCAGGGCAGG - Intronic
1161983444 19:7642181-7642203 CCTGGGGTGGGGTTTAGGGCAGG - Exonic
1162064907 19:8119422-8119444 CCTGGGGTGGGCCTGAGGGATGG - Intronic
1162461391 19:10816171-10816193 GCTGGGGTGTCCCTCAGGTCAGG - Intronic
1162954807 19:14091800-14091822 CCTGGGGTGGGGCCCCGGGTGGG - Exonic
1163386702 19:17004475-17004497 CCTGGGGGGCTGCTCAGGGAAGG - Intronic
1163722636 19:18905530-18905552 TCTGGGCTGTGGCTCAGTGCGGG + Intronic
1163776131 19:19218964-19218986 GCTGGGGTCTGGGTCAGTGCAGG + Exonic
1163846569 19:19641651-19641673 CCTGGGGTCTCCCTGAGGGCTGG + Intronic
1164603485 19:29579328-29579350 GATGGGGTGAGGCTTAGGGCTGG - Intergenic
1164977025 19:32581133-32581155 CGCGGGGCGTGGCTCCGGGCTGG + Exonic
1165199792 19:34134474-34134496 GCTGGGGTGGGGCTAGGGGCCGG + Intergenic
1165490612 19:36120975-36120997 CCTGGGGTGGGAATGAGGGCCGG + Intronic
1165729448 19:38135373-38135395 GCTGGGCTGTGGCTCCGGGCAGG - Intronic
1165855959 19:38879389-38879411 CCAGGGATGGGGCTCAGGACAGG + Intronic
1166051346 19:40262453-40262475 CATGGGGCGTGGCAGAGGGCAGG + Intronic
1166510121 19:43401558-43401580 CCAGGTGCGTGGCTGAGGGCCGG + Exonic
1167048037 19:47062777-47062799 TCTGGGCAGTGGATCAGGGCAGG + Intergenic
1167285992 19:48599276-48599298 CTTGGGCTCAGGCTCAGGGCTGG - Exonic
1167422015 19:49409467-49409489 ACTGGGGTCTGGCACAGGCCTGG - Intronic
1167444331 19:49528445-49528467 CCTGGGGAGTGGCAAAGGCCAGG - Exonic
1167677033 19:50893721-50893743 ACAGGGGTGTAGCTGAGGGCAGG - Intergenic
1167793219 19:51693205-51693227 CCTGGGGTGGGGGTCAGAGATGG - Intergenic
1167834659 19:52058000-52058022 CTTGCTGTGTGGCCCAGGGCTGG - Intronic
1168018608 19:53593248-53593270 CCTGGGGTGGGGGACACGGCTGG + Intergenic
1168133950 19:54338149-54338171 CCTCCGGTGTGCCTCACGGCTGG - Exonic
1168362807 19:55756842-55756864 GCTGGGCAGTGGCTCAGGGTGGG + Intergenic
1202647122 1_KI270706v1_random:152844-152866 CCGGGGATGGGGCTGAGGGCCGG + Intergenic
925190772 2:1881669-1881691 CCAGGGATGTGGCACAGTGCTGG + Intronic
925230264 2:2226706-2226728 TCTGGGCTGGGTCTCAGGGCAGG - Intronic
925274163 2:2637146-2637168 ACTGAGGTGTGGGTCAGGGATGG - Intergenic
925309120 2:2869558-2869580 CCTGGGGTTAGGTTCTGGGCTGG - Intergenic
925457083 2:4024832-4024854 CCTTGGATGTGGGCCAGGGCCGG + Intergenic
925918254 2:8622701-8622723 GCTGGGCTGTGGCGCAGGGCTGG - Intergenic
926017519 2:9467860-9467882 ACTGGGGCGTGGCTCTGGCCAGG + Intronic
926131240 2:10304176-10304198 CCTGGGGGCTGGGGCAGGGCCGG - Intronic
926175018 2:10583087-10583109 CCTGGAGCGTGTCTCAGGGAAGG - Intronic
926247857 2:11133738-11133760 GCTCGGGTCTGGCTCTGGGCTGG - Intronic
926890818 2:17637535-17637557 CCTGGGGTGGGGTTGGGGGCTGG - Intronic
926914750 2:17880329-17880351 CCTGGGGCCTGGCCCATGGCGGG - Intronic
927042553 2:19244384-19244406 ACTGGGTGGTGGCTCAGGGTTGG - Intergenic
927189746 2:20509431-20509453 CCTGGGGTCAGGCTCCAGGCAGG - Intergenic
927292619 2:21419868-21419890 ATAGGGGTGTGGCTCAGGGCAGG + Intergenic
927519623 2:23690962-23690984 CCTGGGGCCTGGCCCGGGGCGGG - Intronic
928093816 2:28392362-28392384 CCTGGGAAGGGGCTCGGGGCGGG - Intergenic
928211442 2:29326907-29326929 CCTGGGGTGGGGCCCAGACCCGG - Intronic
928863427 2:35887877-35887899 TCTGGGTTGTGGCTCAAGACAGG - Intergenic
931104038 2:59034776-59034798 CAAGGGATGTGGCTTAGGGCTGG - Intergenic
931629476 2:64285969-64285991 CCTGGGGTGGGGTTAAGGGTAGG - Intergenic
932493112 2:72133840-72133862 CCTGGGATGAGGCTGAGGGAAGG + Intronic
933582945 2:84147847-84147869 CCTGGGGTGTGGGTGAAGGAAGG - Intergenic
933787166 2:85852562-85852584 CCTGGGGTGGGGTTGAGGGTGGG + Intronic
933831965 2:86218365-86218387 CCTGGTAAGTGGCTCAGTGCTGG + Intronic
934035475 2:88085378-88085400 GCTGGGGTGGGGCTCAGTGCTGG + Intronic
934080806 2:88466273-88466295 CATGTGGTGGGGCACAGGGCTGG + Intergenic
934474813 2:94586950-94586972 CCAGGGCTGGGGCTCAGGGAGGG + Intergenic
934781383 2:96971800-96971822 GCTGGGGCGTGGCTCAGGAGAGG + Intronic
934809323 2:97266969-97266991 CTTGGGGTGTGGCCCAGTGAGGG + Intergenic
934828127 2:97489983-97490005 CTTGGGGTGTGGCCCAGTGAGGG - Intergenic
934857746 2:97739538-97739560 CCTGGGGTGGGGCTGAGGGTGGG - Exonic
935492849 2:103741498-103741520 CCTGGGGTGTGGCTCTGTTACGG + Intergenic
936038536 2:109130560-109130582 CCTGCGGTGTGGCTAAGGAGGGG + Intronic
936042557 2:109160935-109160957 CCAGGGGTGTGGCTGAGAGGAGG + Intronic
936284447 2:111171457-111171479 CCTGAGGTATCGCTGAGGGCAGG + Intergenic
936462194 2:112722100-112722122 CCAGGTGTGTGGCTCAGGACAGG + Exonic
936972305 2:118187200-118187222 AATGGGGGGTGGCTCAGGGCAGG - Intergenic
938064884 2:128276491-128276513 CCTGGGGTGTGGGGCTGGGATGG + Intronic
938092295 2:128441625-128441647 CCTGGGGTGTGGTTCAGGAAAGG + Intergenic
938548124 2:132353279-132353301 CCGGGGATGGGGCTGAGGGCCGG - Intergenic
939829065 2:147050889-147050911 CCTGGGGTGTGGGTTGGGGTTGG - Intergenic
940009928 2:149041715-149041737 CCTAGGGTGTGGCTGAGGGGAGG + Intronic
940011598 2:149060575-149060597 CCTGGGGTTTGGCTGAGACCTGG + Intronic
943947842 2:194090487-194090509 CCTGGGGTGGGGCTCAGGCGTGG + Intergenic
944260254 2:197668585-197668607 CCTGGGTTGTACCTCAGGCCTGG + Intronic
947346052 2:229190335-229190357 CCTGGGGTATAGCTCGGGGCTGG - Intronic
947911504 2:233803766-233803788 CCTGGGGGTTGGCTCAGTCCAGG + Intronic
948011360 2:234651879-234651901 CCGGGGGGGTGGGTCAGGGGAGG - Intergenic
948638787 2:239360152-239360174 CAAGGGCTGTGGCTCAGCGCAGG - Intronic
948809306 2:240466711-240466733 GCTGGGGGGTGGGCCAGGGCTGG - Exonic
948813691 2:240499099-240499121 CCTGGGGTGTTGCTCAGTGGGGG + Intronic
948883204 2:240870717-240870739 CCCGGGGTGGGGGTCAGGGCCGG + Intronic
948886509 2:240887717-240887739 CCTGGGATGAGGGTGAGGGCCGG + Intronic
948929035 2:241119025-241119047 TCTGGGGTGGGCCTCAGGGCTGG - Intronic
949040063 2:241843996-241844018 GCTGGGGTGGGGCGCAGGGGTGG + Intergenic
1168878192 20:1185359-1185381 CCTCGGCAGTGGCTCCGGGCCGG - Intronic
1170568379 20:17619443-17619465 CCTGAGGTGTCTCTCAGGGCAGG - Intronic
1170821913 20:19761267-19761289 CATGGAGTGTGCCTCTGGGCAGG - Intergenic
1171290384 20:23979641-23979663 CCTGAGATGTGGCCCCGGGCTGG + Intergenic
1171876994 20:30586051-30586073 CCCGGGATGGGGCTGAGGGCCGG - Intergenic
1171961286 20:31496867-31496889 CCCTGGCTGAGGCTCAGGGCTGG + Intergenic
1173200567 20:40951830-40951852 GCTGGGGTGTGGCTAAGAACAGG - Intergenic
1173800542 20:45891894-45891916 CCTGGGAGGGGGGTCAGGGCAGG - Exonic
1173839582 20:46148723-46148745 CTGGGGATGTGGCTCAGGGTGGG - Intergenic
1174174736 20:48637497-48637519 CCTGGGCAGTGGCACAGGACAGG + Intronic
1174357322 20:50007169-50007191 CTTGGGGTTTGTTTCAGGGCGGG + Intergenic
1174778876 20:53370294-53370316 CCTGGGGAGCTGCTCTGGGCAGG + Intronic
1175331387 20:58166993-58167015 CCAGGGGTGTGGCCTTGGGCAGG + Intergenic
1175426437 20:58870349-58870371 CCTGAGTGGTGGCTGAGGGCAGG + Intronic
1175787478 20:61721034-61721056 CCTCGGGAGGAGCTCAGGGCAGG - Intronic
1175854465 20:62112987-62113009 CTTGGGTTGTGGCACAGGGCTGG - Intergenic
1176095798 20:63343800-63343822 CCTGGTGCCTGGCACAGGGCGGG + Intronic
1176860633 21:14009918-14009940 CCCTGGGTGTGGCACAGGACAGG - Intergenic
1179507035 21:41848044-41848066 TCTGGGGGCTGGCCCAGGGCAGG + Intronic
1179585205 21:42370244-42370266 CCTGGGCTGTGGCTGAGAGGGGG - Intergenic
1179660484 21:42871426-42871448 CCTGTGGAGGGGCTCAGAGCAGG + Intronic
1179675197 21:42975692-42975714 CCTGAGGTCGGGCCCAGGGCAGG + Intronic
1179886509 21:44316389-44316411 TGTGGGCTGGGGCTCAGGGCTGG + Intronic
1180049069 21:45323180-45323202 CCGTGGGTGTGGGCCAGGGCTGG - Intergenic
1180075220 21:45458564-45458586 GGTGGGGTGTGGCTCCGGGGGGG - Intronic
1180083064 21:45495267-45495289 CCTGGCGTGGGGCTAACGGCAGG + Intronic
1180184151 21:46131268-46131290 CCTGGGTTGTGGCTATGGCCAGG + Intronic
1180767044 22:18351369-18351391 CCTGAGATGTGGCCCCGGGCTGG - Intergenic
1180779269 22:18511010-18511032 CCTGGGATGTGGCCCCGGGCTGG + Intergenic
1180782539 22:18529161-18529183 CTGGGGGTGTGGCTTAAGGCAGG + Intronic
1180811986 22:18768330-18768352 CCTGAGATGTGGCCCCGGGCTGG + Intergenic
1181028655 22:20139663-20139685 GCAGGGATGTGGCACAGGGCTGG - Intronic
1181126091 22:20703190-20703212 CTGGGGGTGTGGCTTAAGGCAGG + Intergenic
1181198141 22:21202574-21202596 CCTGAGATGTGGCCCCGGGCTGG + Intergenic
1181239430 22:21468499-21468521 CTGGGGGTGTGGCTTAAGGCAGG + Intergenic
1181401603 22:22653230-22653252 CCTGAGATGTGGCCCCGGGCTGG - Intergenic
1181446901 22:22983961-22983983 CCTGGTCTGGGGATCAGGGCTGG + Intergenic
1181847148 22:25720039-25720061 CCTGAAGTGTAACTCAGGGCTGG + Intronic
1182703463 22:32259972-32259994 CCTGGGGTTGGGGTCGGGGCAGG - Intergenic
1183187506 22:36300419-36300441 CCTCGGCTGTGGCCCTGGGCTGG - Intronic
1183251428 22:36733023-36733045 CCTGGGGCTTGGCACAGGGCAGG + Intergenic
1183421362 22:37713493-37713515 CCTGGTGTGAGGCTCAGCCCTGG - Intronic
1183605414 22:38864793-38864815 CCCGGGAAGTGGCCCAGGGCTGG + Exonic
1183829523 22:40410426-40410448 CCTGCGGTGGGGCTGAGGGGTGG - Exonic
1183958441 22:41396542-41396564 CCTGGGATGGGGCTTGGGGCTGG + Exonic
1184073850 22:42163680-42163702 CATGGGGTGTGGCTGAGAGACGG + Intronic
1184515186 22:44957392-44957414 CCTGGGCTGCCGCACAGGGCTGG + Intronic
1184607138 22:45580658-45580680 CCTGGGCTCCGGCTCTGGGCGGG - Intronic
1184871148 22:47239244-47239266 GCAGGGCTGTGGGTCAGGGCAGG + Intergenic
1184890004 22:47373793-47373815 CCCGGGGTGTGGCCCGGGGTTGG + Intergenic
1184974335 22:48050413-48050435 GCTGGGGTGAGGGTCAGGGACGG + Intergenic
1185254393 22:49824491-49824513 CCTGGGGACTCGCTCAGGCCTGG - Exonic
1185365902 22:50436635-50436657 CCCTGGGTGTGGCACAGGACGGG - Intronic
1203228666 22_KI270731v1_random:92263-92285 CCTGAGATGTGGCCCCGGGCTGG - Intergenic
950310578 3:11954328-11954350 CATGGAGTCTGGCACAGGGCAGG + Intergenic
950476491 3:13218313-13218335 CCCAGGGTCTGGCTCAGTGCTGG + Intergenic
952878717 3:37969697-37969719 GCTGGGGTAGGGCTGAGGGCAGG - Intronic
953397036 3:42581768-42581790 GTTAGGGTGTGGCGCAGGGCGGG - Intronic
953435025 3:42871374-42871396 GCTGGGGTGAGGCTGAGGGCTGG - Intronic
953908738 3:46881683-46881705 CCTGGGATGGGACTGAGGGCAGG + Intronic
954129138 3:48550902-48550924 CCTGGGGCCTGGCACAGCGCTGG + Intronic
954444786 3:50540801-50540823 CCTGAGGGATGGCTCTGGGCTGG + Intergenic
954649835 3:52154326-52154348 CCTGGGGAGTTGCTCTCGGCTGG + Intronic
955365379 3:58306105-58306127 CTTGGGGTGCGGTTTAGGGCGGG - Intergenic
955842182 3:63124376-63124398 CCTGGGATCTGGCCCAGGGCAGG - Intergenic
960034945 3:113092957-113092979 CCTGGGGCATGGCCTAGGGCAGG - Intergenic
960586315 3:119323685-119323707 CCTGGGCTGTGGCTGAGCCCTGG + Intronic
961652907 3:128426249-128426271 CCTGCTGTGTGGCCCTGGGCAGG + Intergenic
961677868 3:128578507-128578529 GCTGGGGTGGGCCTCATGGCAGG - Intergenic
961831186 3:129623740-129623762 GCTGGGCTGGGGCTCCGGGCTGG + Intergenic
963214009 3:142724473-142724495 CCTGGGGCGTGGCTGGGGTCGGG + Exonic
964088931 3:152850362-152850384 CCCAGGGTGTGGCTCAGGTCAGG + Intergenic
966706429 3:182920887-182920909 GCCTGGGTGTGGCTCAGGTCTGG - Exonic
967826463 3:193881594-193881616 CATGGAGGGTGGCCCAGGGCAGG - Intergenic
967848798 3:194065921-194065943 CCTGCTGTGTGACTTAGGGCTGG + Intergenic
968137974 3:196232731-196232753 CCTGGGTTGGCCCTCAGGGCTGG - Intronic
968274745 3:197431813-197431835 AGTTGGGTGTGGCTGAGGGCTGG - Intergenic
968506914 4:974937-974959 CTTGGGGCCTGGCTGAGGGCAGG - Intronic
968601034 4:1509440-1509462 CCACGGATGTGGCCCAGGGCCGG - Intergenic
968615136 4:1574358-1574380 CTTGGGGGTTGTCTCAGGGCCGG + Intergenic
968731272 4:2270465-2270487 CCTGGTGGCTGCCTCAGGGCAGG - Exonic
968757725 4:2425664-2425686 CCTTGGGTGTGGTGCAGGCCTGG - Intronic
968814102 4:2812775-2812797 GCTGGGGTGGGGCCCAGGTCCGG + Intronic
968817279 4:2828635-2828657 ACTGGGCTGCAGCTCAGGGCTGG - Intronic
969511645 4:7621181-7621203 CCCTGGGCGGGGCTCAGGGCTGG - Intronic
969520373 4:7674708-7674730 CCTGGCAGGTGGCTCAGGGTCGG - Intronic
970384567 4:15543107-15543129 TCTGGGGGGTGGGTGAGGGCAGG + Intronic
971420174 4:26467348-26467370 CCAGGGATGTGACTCTGGGCAGG + Intergenic
972617994 4:40718717-40718739 CCAGGGGAGTGTCTCAGGCCTGG + Intergenic
972632921 4:40857307-40857329 CTAGGGGACTGGCTCAGGGCCGG + Intronic
973373376 4:49271007-49271029 CCGGGGATGGGGCTGAGGGCCGG + Intergenic
973387634 4:49524201-49524223 CCGGGGATGGGGCTGAGGGCCGG - Intergenic
974003112 4:56530530-56530552 GCTGGGGCGGGGCTCGGGGCGGG + Intergenic
975028020 4:69576432-69576454 CCTGGGGAGGGGCTCAGGCATGG + Intergenic
976226089 4:82797028-82797050 TAGGGGGTGTGGCTCAGGGAGGG - Intronic
978665032 4:111172370-111172392 CCTGGCAAGTGCCTCAGGGCAGG - Intergenic
979517971 4:121632934-121632956 CCTGATGAGTGGCTCAGCGCAGG - Intergenic
980958720 4:139453961-139453983 CCTGGCGTGTGGCCGCGGGCAGG + Exonic
982070470 4:151689810-151689832 CCTGGTAAGTGCCTCAGGGCTGG - Intronic
984227805 4:177055880-177055902 CCTGGGGTGGGGGTCAGGGAGGG + Intergenic
984335034 4:178379456-178379478 CCTGTAGTGGGGCTCAGGCCTGG - Intergenic
984770461 4:183432784-183432806 CCTGCCGTGTGGCCCAGGGTTGG + Intergenic
984937766 4:184904268-184904290 CCTGAGGAGTTGCTCTGGGCTGG - Intergenic
985579547 5:689642-689664 CCTAGGGGGTGGCTCTGGGAGGG + Intronic
985594393 5:781701-781723 CCTAGGGGGTGGCTCTGGGAGGG + Intergenic
985631834 5:1017926-1017948 GCTGGGGTGTGGGACAGGCCAGG + Intronic
985633880 5:1026708-1026730 CCTGGCAGGTGGCTCAGGGAGGG - Intronic
985702967 5:1384683-1384705 GCAGGGGTGAGACTCAGGGCTGG - Intergenic
986027827 5:3866806-3866828 CCTGGGGTGGGGCTGAGGGTGGG + Intergenic
986245673 5:6004494-6004516 CCTGGGATGTGGCACAGAGTAGG + Intergenic
990749847 5:59002635-59002657 CCTCAGGTCTGGCTCTGGGCTGG - Intronic
991492368 5:67195654-67195676 ACTGGGGTAAGGCTCAGAGCTGG - Intronic
992139748 5:73783723-73783745 CCTGGGGTGTAGCACTGGGTGGG + Intronic
992934626 5:81688459-81688481 CCTTGGGTGTGACCCAGTGCTGG + Intronic
996379313 5:122847322-122847344 CCTGGAGTGTGGCACATGCCTGG - Intronic
996509887 5:124305962-124305984 GCTGGGGTTTGTCTCAGTGCAGG - Intergenic
997178877 5:131807605-131807627 CCTGGGTGGTGGCTGAGGACAGG - Intronic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
997978499 5:138454297-138454319 CCTGGGGTGGTGCTCAGTCCTGG + Intergenic
998579052 5:143350863-143350885 CCTGGTGTCTAGCACAGGGCTGG + Intronic
999309971 5:150545593-150545615 CCAGGCGCCTGGCTCAGGGCTGG - Intronic
1000062868 5:157671918-157671940 CCTGGGGTGTGAAAAAGGGCCGG - Intronic
1001122597 5:168992633-168992655 CCTGGGGTCCTGCTCAGGCCTGG + Intronic
1001382200 5:171312184-171312206 GCAGGGGTGGGGCGCAGGGCCGG - Intergenic
1001549516 5:172593115-172593137 GATGAGGTGTGGCTCAGTGCTGG + Intergenic
1001674670 5:173502114-173502136 CCGGGGGCGTGGCCCAGAGCTGG - Intergenic
1002346515 5:178551745-178551767 CCTGAGGGGGTGCTCAGGGCAGG - Intronic
1002449279 5:179309881-179309903 CCCTGGGTTTGCCTCAGGGCAGG + Intronic
1004515462 6:16318797-16318819 CCTGTGGGGAGGCTCAGGGATGG + Intronic
1006389967 6:33752413-33752435 CCTGGGGAGATGCTCAGGGCAGG - Intergenic
1007047679 6:38794156-38794178 CCTTGGTTGAGGCTCTGGGCTGG - Intronic
1010793088 6:80087590-80087612 CCTGCCATGTGGCTAAGGGCAGG + Intergenic
1015637757 6:135295694-135295716 CAGGGGATGTGGCTCAGGGAAGG + Intronic
1015683579 6:135834622-135834644 CCTGTGCTGTGGCCCAGGCCGGG - Intergenic
1017086347 6:150716631-150716653 GCTGGGGTGGGGATGAGGGCAGG - Intronic
1018350652 6:162955816-162955838 CCTGGGGTGTGATTCAGGCTGGG - Intronic
1018429154 6:163709844-163709866 CCAGGGCTGTGGCCCAGGGAGGG + Intergenic
1018443437 6:163834335-163834357 CCTGGAGTGAGGCTGGGGGCGGG - Intergenic
1018937289 6:168282034-168282056 CCTGTGGGTTGGCTCAGGCCTGG - Intergenic
1019131625 6:169881101-169881123 CCTGAGGTGTGCCCCGGGGCAGG + Intergenic
1019279978 7:194703-194725 CCTGGGCTGTGGCTCTCGGCAGG + Intronic
1019414421 7:920737-920759 CGTGGTGGGTGGCTCTGGGCAGG - Intronic
1019486430 7:1291485-1291507 CCTGGGATGTGGGCCAGGCCAGG - Intergenic
1019516621 7:1442990-1443012 CCTGGTGTGTGCCTGAGGGAAGG - Intronic
1019572294 7:1718911-1718933 CCTGGAGTGTGGCTCCGCGGAGG - Intronic
1019632783 7:2058626-2058648 CCAGGGGAGAGGCGCAGGGCTGG + Intronic
1019632850 7:2058898-2058920 CCAGGGGAGAGGCGCAGGGCTGG + Intronic
1019632871 7:2058975-2058997 CCAGGGGAGAGGCGCAGGGCTGG + Intronic
1019733861 7:2641090-2641112 GCTGGGGTGTGGCTCGGGGCAGG - Intronic
1019951633 7:4377781-4377803 CCTGGGGTGTCGTTGAGGGAGGG + Intergenic
1020003476 7:4768846-4768868 ACTGGGCTGTTTCTCAGGGCAGG - Exonic
1020098160 7:5379915-5379937 CCTTGGGGGTGGCTGATGGCCGG - Intronic
1022140069 7:27486157-27486179 CCTGGGGAGTGGGGCAGGGATGG + Intergenic
1022443964 7:30455042-30455064 CCTGAGGTGGCACTCAGGGCTGG + Intronic
1022495138 7:30848376-30848398 CCTGCTGTGTGGCCCAGGCCAGG - Intronic
1023043240 7:36190859-36190881 CCTGGGATGTGTCTCAGGACAGG + Intronic
1023274459 7:38502995-38503017 ACTTGGCTGTGACTCAGGGCAGG + Intronic
1024983181 7:55174294-55174316 CATGGGGTGCAGCACAGGGCGGG + Intronic
1026977056 7:74505409-74505431 CCTGGGCTGTGGCTCGGGACAGG + Intronic
1027182061 7:75947846-75947868 GCTGGAGAGTGGCTCAGGGTGGG + Intronic
1027232713 7:76281892-76281914 CCTGGAGGGTAGCTCAGCGCGGG - Intronic
1027289699 7:76692646-76692668 ACATGGGTGTGGCTCATGGCAGG - Intergenic
1029443258 7:100599890-100599912 CCTGGGGCGTGGGACAGTGCTGG + Intronic
1029546533 7:101213058-101213080 CCTGGGGGTTGGGGCAGGGCGGG + Intronic
1029686158 7:102149535-102149557 CCTTGGGTGTGGTTCATGGTAGG + Intronic
1029687238 7:102157183-102157205 CCTTGCGTGTGGCTGAGGGAGGG + Intronic
1031041566 7:116843626-116843648 CCTGGGGTGTGGCACACTGACGG - Intronic
1032084070 7:128874490-128874512 CTGGGGGTGTGGCTGAGGCCAGG - Intronic
1032488809 7:132308453-132308475 CATGGTGTGTGGCGCATGGCAGG - Intronic
1033163552 7:139018459-139018481 ACTGGGGTATGGCTTAGGCCAGG - Intergenic
1033732658 7:144194975-144194997 ACTGGGGTGAGGGGCAGGGCAGG + Intronic
1033743509 7:144293555-144293577 ACTGGGGTGAGGGGCAGGGCAGG + Intergenic
1033750393 7:144356042-144356064 ACTGGGGTGAGGGGCAGGGCAGG - Intronic
1034345106 7:150381180-150381202 CCAGGGGTGTGGCGCAGGGGAGG + Intronic
1034352043 7:150422595-150422617 TCTGGGGTGTGGGTGAGGGTGGG + Intergenic
1034459072 7:151187942-151187964 CCTGGGGTGAAGCTCAGGGTTGG - Intergenic
1034498723 7:151436718-151436740 CATGGGCTGTGGCCCAGGGGTGG - Intronic
1034503557 7:151467778-151467800 CCTGGGCTGAGGCTGAGGGCAGG - Intronic
1034513376 7:151553985-151554007 CCTGGGTGGTGGATAAGGGCAGG - Intergenic
1034681850 7:152934886-152934908 CCTGGGGAGAGGGTCAAGGCGGG - Intergenic
1034964858 7:155384626-155384648 CCTGGATTCTGGTTCAGGGCGGG - Intronic
1035283728 7:157793508-157793530 CCTGGGGTGGGGGCAAGGGCGGG + Intronic
1035471154 7:159109609-159109631 TCTGGGGTTTGGCTGAAGGCAGG + Intronic
1035625693 8:1068920-1068942 CCGGGGGCTGGGCTCAGGGCAGG + Intergenic
1035727176 8:1831886-1831908 CCTGGAGGGTGGCACATGGCCGG + Intronic
1036703937 8:11032560-11032582 CCTGGTGTCTGGCACAAGGCAGG + Intronic
1038117791 8:24577472-24577494 CCTAAGGAGTGACTCAGGGCTGG - Intergenic
1038476454 8:27871859-27871881 CCTGGGGTGGGGCACAGCTCGGG - Exonic
1038490208 8:27965326-27965348 CCTCGGGTGAAGCCCAGGGCAGG - Intronic
1038611546 8:29064031-29064053 CCTGGGGTGGGACTGAGGGAGGG + Intronic
1039399995 8:37261318-37261340 TCTGGGCTGTTGCTCAGAGCTGG + Intergenic
1039476292 8:37841022-37841044 GCTGGGGTGGGGCTGGGGGCCGG - Intronic
1042111902 8:65389800-65389822 TCAGGGGTTTGGTTCAGGGCAGG + Intergenic
1043753526 8:83970961-83970983 CCTGGCGTGGGGCTCCGGGTGGG + Intergenic
1044147352 8:88733424-88733446 ACTGGGGTGGGGCTGAGGGGAGG + Intergenic
1044429051 8:92087192-92087214 CCTGTGGAGTGCCTCAGGGTTGG - Intronic
1045002808 8:97893153-97893175 CCTGGGTTGTGGCAAAGAGCAGG + Intronic
1045638315 8:104218826-104218848 CCTACTGTGTGGCTCAGGGTAGG + Intronic
1046456577 8:114472214-114472236 CCTGGTATGTGGCATAGGGCAGG + Intergenic
1047179836 8:122576596-122576618 CCAGGGGTGGGGATCAGGGTGGG - Intergenic
1047404163 8:124571182-124571204 CCTGGAATCTGCCTCAGGGCAGG + Intronic
1047623794 8:126635130-126635152 GCTGCACTGTGGCTCAGGGCAGG + Intergenic
1048112883 8:131487295-131487317 CCTGGGGAGAGGCTCAGGCATGG - Intergenic
1048311132 8:133323300-133323322 CCTGGCGGGTCGCCCAGGGCAGG - Intergenic
1048341826 8:133546091-133546113 TCTGGTGTGTGGCTCTGTGCCGG - Intronic
1048769375 8:137879624-137879646 CCAGGGGTGTGGCACGTGGCTGG - Intergenic
1049404731 8:142447327-142447349 CCTGGGGAGGGGCTGAGGGCTGG + Intergenic
1049476868 8:142800989-142801011 CCTGGGGTCTGGACCAGGGCAGG + Intergenic
1049480456 8:142820071-142820093 CCAAGGGTGTGACCCAGGGCTGG + Intergenic
1049545248 8:143227791-143227813 GCAGGGGTGGGGCCCAGGGCAGG - Intergenic
1049600830 8:143506821-143506843 CCTGGGGTTAGCCTCAGGCCTGG + Intronic
1049757509 8:144317301-144317323 CCTGGGGTGTCCCTGGGGGCTGG - Intronic
1049827483 8:144678862-144678884 ACAGGGGAGTGGCTCAAGGCTGG + Intergenic
1051822989 9:21190870-21190892 CCTGGAGTCTTGCTTAGGGCAGG - Intergenic
1051824813 9:21209405-21209427 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1051826809 9:21231482-21231504 CCTGGAGTCTTGCTTAGGGCAGG - Intronic
1052855237 9:33402809-33402831 CCAGGGCTGGGGCTCAGGGAGGG - Intergenic
1052872649 9:33523701-33523723 CCGGGGATGGGGCTGAGGGCCGG - Intergenic
1053511417 9:38691048-38691070 TCTGGTGTGGGGCTCAGGGATGG - Intergenic
1053683249 9:40499151-40499173 CCAGGGCTGGGGCTCAGGGAGGG - Intergenic
1053933230 9:43127467-43127489 CCAGGGCTGGGGCTCAGGGAGGG - Intergenic
1054280465 9:63125777-63125799 CCAGGGCTGGGGCTCAGGGAGGG + Intergenic
1054296354 9:63334649-63334671 CCAGGGCTGGGGCTCAGGGAGGG - Intergenic
1054394371 9:64639154-64639176 CCAGGGCTGGGGCTCAGGGAGGG - Intergenic
1054429020 9:65144353-65144375 CCAGGGCTGGGGCTCAGGGAGGG - Intergenic
1054501364 9:65877182-65877204 CCAGGGCTGGGGCTCAGGGAGGG + Intergenic
1054927092 9:70600496-70600518 CCTGGGCTAGGGCTTAGGGCAGG - Intronic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1055357679 9:75454230-75454252 CCTGGGGTCTGGCTGCTGGCAGG - Intergenic
1055649931 9:78397305-78397327 TCTGAGGGGAGGCTCAGGGCTGG - Intergenic
1055736438 9:79336113-79336135 CATGGGGTGTGGCAGGGGGCAGG + Intergenic
1057125295 9:92611607-92611629 CCTGGGGTGGGCCCCAGGACTGG - Intronic
1057144188 9:92747474-92747496 CCAGGGATATGGCTCAGGACAGG + Intronic
1057210566 9:93198930-93198952 CCTCGGGTGTGAGTCAGGCCTGG + Intronic
1057481634 9:95449264-95449286 GCTGGGGGGTGGCTCAGGGGAGG + Exonic
1057684799 9:97222124-97222146 CCGGGGATGGGGCTGAGGGCCGG + Intergenic
1057819747 9:98321891-98321913 GCTGGGCTGTGGCCCTGGGCAGG - Intronic
1058424439 9:104864293-104864315 CCTGGGGTGTGGCCTGGGGATGG - Intronic
1060137254 9:121169450-121169472 CCTTTGGTGTGGGTCAGGGTAGG + Intronic
1060374620 9:123107250-123107272 CTTGGGGTGGGGATGAGGGCAGG + Intergenic
1061204010 9:129152680-129152702 GCAGGGGTGTGGCTGAGTGCTGG - Intergenic
1061232559 9:129323217-129323239 TCTCGGGTGGGGCTCAGGGTGGG - Intergenic
1061374806 9:130217519-130217541 CCTTGGGTGGAGCACAGGGCTGG + Intronic
1061513727 9:131076501-131076523 CATGGTGACTGGCTCAGGGCTGG - Intronic
1061840565 9:133356518-133356540 CCGGGGGCGGGGCTCTGGGCGGG - Intronic
1062012529 9:134274713-134274735 CTTGCTGTGTGACTCAGGGCAGG + Intergenic
1062028248 9:134350397-134350419 CCTGGGTGGTGGCTCAGAGCTGG + Intronic
1062042931 9:134412401-134412423 CCTGGGGTTGGTCCCAGGGCTGG + Intronic
1062119052 9:134824290-134824312 CCTTTTGTGTGGCTGAGGGCAGG + Intronic
1062222214 9:135422818-135422840 CCTGGGTCCTGGCTCTGGGCTGG - Intergenic
1062278418 9:135741343-135741365 CCTGGCCTGTGGGTCAGGTCCGG - Intronic
1062344138 9:136107084-136107106 GCTGGGGTTGGACTCAGGGCGGG - Intergenic
1062460422 9:136660455-136660477 CCTGGGGAGGGGCTGGGGGCAGG + Intronic
1062464732 9:136675944-136675966 GGTGGGGTCTCGCTCAGGGCAGG - Intronic
1062465216 9:136677858-136677880 CCTGTGGGGTGGATGAGGGCTGG - Intronic
1062531103 9:137000803-137000825 ACTGGGGTGTGGCCCTGTGCAGG - Intergenic
1062589528 9:137267145-137267167 CCAGGGGGCTGCCTCAGGGCTGG + Intronic
1062609926 9:137369124-137369146 CGTGGGGAGGGGCGCAGGGCCGG + Intronic
1203552125 Un_KI270743v1:172019-172041 CCGGGGATGGGGCTGAGGGCTGG - Intergenic
1185584081 X:1232320-1232342 CATTGCGTGTGGCTCAGCGCTGG + Intergenic
1185796276 X:2967741-2967763 CCGGGGCTGAAGCTCAGGGCGGG - Intronic
1185830071 X:3292954-3292976 GGTGGGGTGTGTCTCAGTGCTGG + Intergenic
1186481384 X:9898479-9898501 CCTGGGATGTGTCTCCAGGCAGG - Intronic
1186534639 X:10333779-10333801 CCCTGGGCCTGGCTCAGGGCTGG + Intergenic
1186718987 X:12282275-12282297 CCAGGTGGGTGGGTCAGGGCAGG + Intronic
1186795638 X:13044402-13044424 CCTGGGGCCTGGGTCAGGGCAGG - Intronic
1187533412 X:20116495-20116517 CATGGGGGGTGGCTTAGGGTGGG - Intronic
1189006349 X:36999291-36999313 CTTGGGGTTAGGCTCAGGGGAGG + Intergenic
1189006442 X:36999848-36999870 CTTGGGGTTGGGCTCAGGGGAGG + Intergenic
1189042245 X:37554514-37554536 CTTGGGGTTAGGCTCAGGGGAGG - Intronic
1189242661 X:39537541-39537563 CCTGGGGTGGGGTGCAGGGGTGG + Intergenic
1189277733 X:39798946-39798968 CCTGGGGTGGGGCCCAGGAATGG + Intergenic
1189301388 X:39955053-39955075 GGTGGGGAGTCGCTCAGGGCGGG - Intergenic
1190061149 X:47212514-47212536 TATGGGGTGGGGCTCAGGACAGG + Intronic
1190739906 X:53281748-53281770 CCTGGGGTTTGGCCCAGAGGAGG - Intronic
1190885630 X:54529358-54529380 CCTGGGGTGGGGCACAGAGTAGG - Intergenic
1192180066 X:68910807-68910829 CCTGGGCTGGGGCTGGGGGCTGG + Intergenic
1193462830 X:81810816-81810838 CCTGTGGGGAGGCTCAGCGCTGG + Intergenic
1198015160 X:132602886-132602908 CCTGGAGTGAGAGTCAGGGCTGG + Intergenic
1198342906 X:135732418-135732440 GCTGGGGTGGGGCTCAGGCAGGG - Intergenic
1198345083 X:135750877-135750899 GCTGGGGTGGGGCTCAGGCAGGG + Intergenic
1198568073 X:137925616-137925638 CTTGGGTTGTGGCTCATGCCTGG + Intergenic
1199949816 X:152698907-152698929 CCTGCGGGGTGGCCCAGGCCCGG - Intronic
1199959858 X:152769554-152769576 CCTGCGGGGTGGCCCAGGCCCGG + Intronic
1200142548 X:153909243-153909265 CCTGGGGTGTGGCCAAGGAAAGG + Intronic
1201153406 Y:11107592-11107614 CCGGGGATGGGGCTGAGGGCCGG - Intergenic