ID: 1147562948

View in Genome Browser
Species Human (GRCh38)
Location 17:41520124-41520146
Sequence TGCAGCATGGTGAAGTGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147562936_1147562948 22 Left 1147562936 17:41520079-41520101 CCCCAGGGCTTACAGAAACTCAG 0: 1
1: 1
2: 1
3: 24
4: 212
Right 1147562948 17:41520124-41520146 TGCAGCATGGTGAAGTGGACAGG 0: 1
1: 0
2: 0
3: 24
4: 199
1147562935_1147562948 27 Left 1147562935 17:41520074-41520096 CCTGGCCCCAGGGCTTACAGAAA 0: 1
1: 0
2: 2
3: 16
4: 206
Right 1147562948 17:41520124-41520146 TGCAGCATGGTGAAGTGGACAGG 0: 1
1: 0
2: 0
3: 24
4: 199
1147562939_1147562948 20 Left 1147562939 17:41520081-41520103 CCAGGGCTTACAGAAACTCAGGA 0: 1
1: 0
2: 1
3: 23
4: 243
Right 1147562948 17:41520124-41520146 TGCAGCATGGTGAAGTGGACAGG 0: 1
1: 0
2: 0
3: 24
4: 199
1147562937_1147562948 21 Left 1147562937 17:41520080-41520102 CCCAGGGCTTACAGAAACTCAGG 0: 1
1: 0
2: 3
3: 28
4: 194
Right 1147562948 17:41520124-41520146 TGCAGCATGGTGAAGTGGACAGG 0: 1
1: 0
2: 0
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147562948 Original CRISPR TGCAGCATGGTGAAGTGGAC AGG Exonic
900757095 1:4443544-4443566 TGCTCCAGGGTGAAGTGGGCAGG - Intergenic
903569243 1:24292194-24292216 GGCAGAATGGGGAAGGGGACTGG + Intergenic
903640517 1:24856780-24856802 GGCAGCATGGGGAGGTGGAGAGG + Intergenic
904318245 1:29679988-29680010 TGAAACAGGGTGAAGGGGACAGG - Intergenic
906259680 1:44377633-44377655 TCCAGCATGGAGAAGCCGACTGG + Intergenic
906843951 1:49169862-49169884 GGCAGCATGGTTTAGTGGAAAGG - Intronic
907249458 1:53128566-53128588 TGCATCATGGAGAAGTGGGCAGG + Intronic
910091828 1:83473559-83473581 CTCAGGATGGTGAAGTGGAGTGG - Intergenic
912041466 1:105396685-105396707 TGCAGAATGGGGAATTGGAAAGG + Intergenic
912500204 1:110116638-110116660 TGCAGCATGGTGCAGCAGAGGGG + Intergenic
912800891 1:112719145-112719167 AGCAACTTGGTGAAGGGGACAGG + Intergenic
912961269 1:114197707-114197729 AGCTGAATGGTGAAGTGAACTGG + Intergenic
913273922 1:117120105-117120127 TGGAGCTTGGTGAGGTGGGCTGG - Intronic
916326049 1:163561320-163561342 TGCAGAATTGTGAATTGGAGAGG - Intergenic
917644954 1:177020731-177020753 TGAAGCATGGTGCAGGTGACAGG + Intronic
918307650 1:183261601-183261623 TGCAGCATTGTGAACTTAACGGG - Intronic
919844045 1:201629705-201629727 GGCAGCATAGGGAAGTGGCCAGG + Intronic
920439002 1:205966183-205966205 TCCAGGAGGGAGAAGTGGACTGG + Intergenic
921427743 1:215023885-215023907 GGCAGCAAGGTGAAGTGGAGGGG - Intronic
922729065 1:227940654-227940676 TGCAGCCAGGGGAAGTGGGCTGG - Intronic
922810961 1:228415352-228415374 AGCAGCAGGCGGAAGTGGACGGG - Exonic
923679791 1:236110335-236110357 TGCAGCATGGCCACGTGGTCCGG - Intergenic
923989477 1:239419782-239419804 TGAAGAATGGTGAAATGTACAGG - Intronic
924953917 1:248909483-248909505 TGCAGCAGGTTGAGATGGACGGG + Intronic
1062951536 10:1507389-1507411 TGCAGCCTGGTGAAGGGGGCAGG - Intronic
1063698718 10:8363973-8363995 TGCAGCGTGGGGGAGTGGAGAGG + Intergenic
1064328218 10:14370617-14370639 TGCAGCCTGGTGGAGGAGACTGG - Intronic
1066044649 10:31584599-31584621 TGCAGCCTGGGGAAGGTGACAGG - Intergenic
1067258650 10:44666881-44666903 TGCAGCTTGGTGAGCTGGCCAGG + Intergenic
1069637119 10:69931641-69931663 TGCCCCATGGTGCAGTGGACAGG - Intronic
1069694861 10:70379270-70379292 GGCAGCATGGTGAAGTTGTTGGG - Intronic
1071516425 10:86300779-86300801 TGCATCAGGGTGGAGCGGACTGG - Intronic
1072088375 10:92102487-92102509 TGCAGCCTGGTGATGGGGGCAGG - Intronic
1073879585 10:107965295-107965317 TGCAGAATGGTAAAGTGTATTGG - Intergenic
1074527507 10:114275045-114275067 TGGAGCATGGAGGAGGGGACAGG + Intronic
1074679760 10:115893249-115893271 AGCAGCCAGGTGAAGTGGAGAGG + Intronic
1074971555 10:118543578-118543600 TGCAGAATGGGGAAGGGGACTGG + Intergenic
1075926717 10:126257041-126257063 TGCAGGATGCAGAAGTGGACTGG - Intronic
1076686903 10:132202283-132202305 CGCAGCGAGGTGACGTGGACAGG - Intronic
1079329716 11:19523316-19523338 AGCAGCAAGGTGAAATGGATGGG + Intronic
1079378901 11:19919452-19919474 GTCAGCCTGGTGAAGTTGACGGG + Intronic
1085961681 11:81469380-81469402 TCCAGCAAGGTGAAGAGAACAGG + Intergenic
1086466312 11:87057460-87057482 GGCAGCATGGTGTAATGCACTGG + Intronic
1086873268 11:92064872-92064894 TGCAGAATGGTGAAGTGAATTGG - Intergenic
1091308689 11:134557809-134557831 TGCTGCAGAGTGAAGTGGAGAGG + Intergenic
1099557641 12:84129221-84129243 TGCAGCTTGGTCGAGTGGAGGGG - Intergenic
1099679369 12:85805756-85805778 TGCATCATAGAGAAGTGGAGAGG - Exonic
1101090734 12:101282325-101282347 TTTAGCATGGTAAAGAGGACAGG + Intronic
1101489027 12:105195016-105195038 AGCAGCATGGTCCAGTGGAAAGG + Intronic
1101572852 12:105971062-105971084 TGCAGCATGGTAAAGAGTTCTGG + Intergenic
1101724229 12:107375944-107375966 TGGCGCATGGGGAAGTGGGCTGG - Intronic
1104675010 12:130706568-130706590 GGCAGCATGGCGTAGTGGCCAGG + Intronic
1109008524 13:56909847-56909869 TGCAGCTTGGTGAGCTGGCCAGG - Intergenic
1110671973 13:78191273-78191295 TGCAGAGTGGTGCAGTGGAGGGG - Intergenic
1110699960 13:78535524-78535546 TAAAGCATGGTGAAGAGAACTGG + Intergenic
1111800818 13:92978339-92978361 GGCAGCATGGCGGAGTGGAATGG + Intergenic
1113031945 13:106003122-106003144 TGCGGTATTGTGAAGTGTACAGG + Intergenic
1114784948 14:25585885-25585907 TGGAGCATGGTGGAGGGGAGGGG - Intergenic
1116505421 14:45672501-45672523 TGCAGCAACATGAATTGGACTGG - Intergenic
1118729562 14:68656774-68656796 TGCAGCATGGCAGAGAGGACCGG + Intronic
1118836448 14:69481527-69481549 TGCTGCAAGGTGAAGGGGAAGGG + Intergenic
1119496483 14:75084066-75084088 TGCAGAGTGGTGAAGTAGTCTGG - Exonic
1120982829 14:90306237-90306259 TGAACCAAGGTGAAGTGGAGCGG - Intronic
1121540001 14:94718457-94718479 AACAGCCTGCTGAAGTGGACAGG + Intergenic
1121549080 14:94784735-94784757 AGCTGCTTGGTGCAGTGGACAGG + Intergenic
1122938687 14:104971676-104971698 TGCAGCAGGGTGAGGTGACCAGG - Intronic
1129857184 15:78832743-78832765 TGCAGTTTGGAGAAGGGGACAGG + Intronic
1135891380 16:26360444-26360466 TGCAGCCTTGTGAAGTGGTGGGG - Intergenic
1136024179 16:27459370-27459392 GGCAGAATGGGGATGTGGACTGG + Intergenic
1136367221 16:29814346-29814368 TGCAGCAGGGGGACGTGGACGGG + Exonic
1138444312 16:57053918-57053940 TGCAGCAGGGTGAAGGGTGCTGG + Intronic
1139285938 16:65814083-65814105 TGGAGCATGGTGAAGAGGGAAGG + Intergenic
1140911209 16:79454723-79454745 TTCAGCATGGTGACCTGGAGAGG + Intergenic
1141944916 16:87303341-87303363 TGCAGAACTGTGAAGGGGACAGG + Intronic
1142435147 16:90052049-90052071 TGCAGCCTGGTCATTTGGACAGG + Intergenic
1144052263 17:11507234-11507256 TGAAGGAAGGTGAATTGGACAGG + Intronic
1145984045 17:29032415-29032437 AGCAGCCTCGTGAAGTGGACAGG - Intronic
1147021333 17:37536267-37536289 AGCAGCATTGAGAAGTGGATTGG - Intronic
1147535885 17:41323227-41323249 CCCAGCATGGTGGAGTGGAGAGG - Intergenic
1147562948 17:41520124-41520146 TGCAGCATGGTGAAGTGGACAGG + Exonic
1148719385 17:49739920-49739942 AGCTGCATGGTGAAATGGCCTGG - Intronic
1149417152 17:56471217-56471239 AGCAGCATGGTGAAATGGGAAGG - Intronic
1151750929 17:76037155-76037177 TGCAGCATCGTGAGGGGGACGGG - Intergenic
1152016467 17:77754074-77754096 GGCAGCATGGTGCAGTGGCTAGG + Intergenic
1152206837 17:78978701-78978723 TGCAGCAGAGTGAAGTGGCTGGG - Intronic
1152572584 17:81127184-81127206 GGCAGCCTGGGGAAGTGGCCAGG + Intronic
1157844685 18:50992435-50992457 TGCAGTATGGAGAATGGGACTGG - Intronic
1162433358 19:10642639-10642661 TGCAGCCTGGGCCAGTGGACAGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1167068591 19:47205896-47205918 TGCCCCGTGGTGAAGAGGACAGG - Intronic
925435763 2:3836389-3836411 TGCAGCATGCTGTCCTGGACTGG + Intronic
926072669 2:9912004-9912026 TGAAGCATTGTGAAGTGGATAGG - Intronic
930075718 2:47403899-47403921 AGCAGTATGATGAAGTGGTCAGG + Intronic
931212560 2:60211861-60211883 AGCACAATTGTGAAGTGGACAGG - Intergenic
931414997 2:62072603-62072625 TGCAGCTTGGTGAGCTGGCCAGG - Intronic
932575572 2:72960665-72960687 TGCAGCAAGGTGATGTGGCCTGG - Intronic
935687720 2:105698738-105698760 AGCAGAATGGAGAAGTGGATTGG - Intergenic
938649581 2:133368627-133368649 TGCAGCCTGGAGAAATGGAGAGG - Intronic
940071983 2:149698882-149698904 TGAAGCATAGTGAATTGGAGGGG + Intergenic
941334978 2:164230813-164230835 TGAAGCCTGGTGAAATGGACAGG + Intergenic
942168134 2:173262643-173262665 TCCAGCCTGGATAAGTGGACTGG - Intronic
942870355 2:180727162-180727184 AGCAGCATGGGGAAATGGAGTGG - Intergenic
945283285 2:208057738-208057760 TGCAGCATGGTGGAGGTGGCTGG + Intergenic
945291917 2:208135312-208135334 TGCAGCCTTCTGAAGTGGAGGGG - Intergenic
945885321 2:215369921-215369943 AGCAGCATGGTGAGATGGAGAGG + Intronic
946045216 2:216815275-216815297 TGCAGCAGGGTGAGGTGAAATGG - Intergenic
947073674 2:226318773-226318795 TGAAGCATGGTGGAGTGGCGAGG + Intergenic
947763318 2:232619746-232619768 TGGAGCCTGGTGCAGTGGCCTGG + Intronic
948249583 2:236515157-236515179 TGAAGCTTGGTGAAGGAGACAGG + Intergenic
948940205 2:241191515-241191537 TGGAGGATGGTGGAGGGGACTGG - Intronic
1169844807 20:9977990-9978012 TGCAGAATTGTGAAATAGACTGG - Intergenic
1170736499 20:19017716-19017738 GGCAGCATGGTGTTGGGGACAGG - Intergenic
1171345729 20:24464836-24464858 TGCAGCATGGTATGGTGGAGAGG - Intergenic
1173644211 20:44623435-44623457 TGCAGCATGGTGGAGAAGTCAGG - Intronic
1174453165 20:50631966-50631988 TGCAGGAAGATGAGGTGGACTGG - Intronic
1176756604 21:10730367-10730389 TGCAGCAAAGTGGAGTGGAGTGG - Intergenic
1178346058 21:31829167-31829189 TGAGGCATGGTGAAGAGGGCTGG + Intergenic
1182951534 22:34380807-34380829 TGCAGGCTGGTGATTTGGACAGG - Intergenic
1203308914 22_KI270736v1_random:128872-128894 TGGAGAGTGGTGGAGTGGACTGG + Intergenic
1203312708 22_KI270736v1_random:153936-153958 TGCAGCATAGTGGAGTGGAATGG + Intergenic
950327769 3:12128402-12128424 GGCAGCATGGTGGAATGGAAAGG + Intronic
957058557 3:75462859-75462881 TGCAACATTGTCAAGTGGTCAGG + Intergenic
957617498 3:82550093-82550115 TGGAGCATGGAGAAGTGACCAGG - Intergenic
959830448 3:110855470-110855492 TACAGCATGGTAAAGAGGATAGG + Intergenic
962389608 3:134960209-134960231 TGCAGTAGGGTGAAGAAGACTGG + Intronic
962847273 3:139283578-139283600 TGCAGTCTGGTGGAGTGGACAGG + Intronic
962867700 3:139461220-139461242 GGCAGCAGGGAGAAGTGGAGAGG - Intronic
962976541 3:140451006-140451028 TGCAGAATGGAGGAGAGGACTGG - Intronic
966254227 3:177899321-177899343 TGCAGCTTGGTGAGCTGGCCAGG - Intergenic
968268284 3:197379483-197379505 TGCAGGAGGGGGAAGTGGAGAGG - Intergenic
969587515 4:8102985-8103007 TGCAGCCTGGAGATGTGCACAGG - Intronic
969656748 4:8503178-8503200 TGCAGCCTGGGGAAGGGGTCGGG - Intergenic
969869546 4:10096089-10096111 AGCAGCCTGGTGAAGAAGACAGG + Intronic
971451235 4:26803901-26803923 TGCAGCAAAGAGAAGGGGACGGG + Intergenic
975315343 4:72945811-72945833 TGCAGCTTGGTGAGCTGGTCAGG + Intergenic
975684239 4:76903880-76903902 TGAAGCATGGTGGAGGGGAGAGG + Intergenic
975958971 4:79877818-79877840 TGCAGCATGGTGAATAGGATAGG - Intergenic
976972691 4:91126897-91126919 TGCAGAAACTTGAAGTGGACAGG + Intronic
978592693 4:110343347-110343369 TGCAGCTTGGTGAGGTGGTGGGG - Intergenic
980738101 4:136917394-136917416 TGCAGCATGGTGGTGTGGCTGGG + Intergenic
984098056 4:175455502-175455524 AGCAGCATGGGGAACTGGAAAGG + Intergenic
984414167 4:179435696-179435718 TGCATCATCGTGACGTGGAAGGG - Intergenic
985809939 5:2075504-2075526 TGGAGCAGGGTGGAGGGGACGGG + Intergenic
985914982 5:2910702-2910724 TGGGGCATGGTGGAGTGGAGTGG + Intergenic
985969560 5:3364299-3364321 TGAAGCCTGGTTAGGTGGACAGG + Intergenic
986423968 5:7612430-7612452 TGAACCATGGTGAGGTGGGCAGG + Intronic
989425369 5:41290428-41290450 TGCAACATGGTGAGGTGGAGTGG + Intergenic
991239232 5:64438282-64438304 TGCAGCAAGGAGAAGTGCAGAGG - Intergenic
996774325 5:127117824-127117846 TGCAGGATGGTCAGGTGGTCCGG - Intergenic
998005073 5:138651389-138651411 TGCAGCACGGTGAAGGGCAGTGG + Intronic
998091793 5:139375309-139375331 GGCAGTATGGTGCAGTGGATGGG + Intronic
998500273 5:142626664-142626686 TGCACCCCGGTGAAGAGGACAGG - Intronic
999143694 5:149379217-149379239 TGCAGCTTGGCGGAATGGACTGG - Exonic
1001434208 5:171686809-171686831 TTCAACTTGGTGAAGTGGGCAGG + Intergenic
1002044763 5:176535820-176535842 GACAGCATGGAGATGTGGACGGG - Intronic
1002487444 5:179549283-179549305 TGCAACCTAGTGAAGTGGGCTGG + Intergenic
1005659231 6:27977587-27977609 TGCAGCCTGGGGGAGTGGACTGG + Intergenic
1007685599 6:43665639-43665661 AGCAACATGGTGGGGTGGACTGG - Intronic
1008801260 6:55370997-55371019 TGCAGGATGGCGAAGTGAAGGGG - Intronic
1009983335 6:70752115-70752137 TGCTGCATGGTGATATGGATTGG + Intronic
1009989074 6:70818549-70818571 GGCAGGATGTTGAAGTGGAGAGG + Intronic
1011981670 6:93386636-93386658 TGCAGAAGGGAAAAGTGGACTGG - Intronic
1012132897 6:95519162-95519184 TGCAGCTTGGTGAGCTGGCCAGG + Intergenic
1014255860 6:119159629-119159651 CCCAGCATGGTGAAGTGGTGTGG - Intergenic
1014391942 6:120874034-120874056 TGCAGCTTGGTGAGCTGGCCAGG - Intergenic
1015031470 6:128600969-128600991 TGCATCACAGTGAAGTGGAGGGG + Intergenic
1017444117 6:154492052-154492074 TGCAGGTTGGTGAACTTGACAGG - Intronic
1018698003 6:166405628-166405650 TGCAGAGTGGTGAAGGGGAGGGG + Intergenic
1018903734 6:168063605-168063627 TGCAGCCTGAAGAAGTGCACGGG + Exonic
1019088891 6:169507817-169507839 TGACACATGGTGAAGTGGAGTGG + Intronic
1019452410 7:1106608-1106630 TGCAGCCTGGTGAGGGTGACGGG + Intronic
1020961540 7:14810635-14810657 TGCAGCCTGCTGAAGTGCAGTGG + Intronic
1022036218 7:26537360-26537382 TGCTGCATGGTGGAGTGGAAAGG + Intronic
1022411151 7:30139649-30139671 TTCTGCATGGTGGAGAGGACAGG - Intronic
1023122647 7:36925179-36925201 TGCAGCCTTGGGAAGTGGAATGG - Intronic
1025944003 7:66092670-66092692 GGCAGCATGGGGAAGGGGATGGG - Intronic
1027308685 7:76930047-76930069 CTCAGGATGGTGAAGTGGAGTGG - Intergenic
1028198927 7:87937937-87937959 AGCAGCATGGTAAAGTGCAGTGG - Intronic
1030147476 7:106371286-106371308 TGGAGCATGGGGAAGTGGGCAGG - Intergenic
1030416164 7:109246299-109246321 TGAAGCACAGTGATGTGGACTGG + Intergenic
1033818165 7:145100801-145100823 TGCAGAATGGATAAGTGGAGAGG - Intergenic
1035772968 8:2164200-2164222 TACAGCATGGTGTAGTCCACAGG - Intronic
1039079025 8:33717909-33717931 TGGGCCATGGTGAAGTGGTCGGG + Intergenic
1039945965 8:42129008-42129030 AGCAGCATGGTGAAGTTGATGGG + Intergenic
1040299235 8:46179424-46179446 TGCAGCAGGGTGTCGTGGGCAGG - Intergenic
1040338895 8:46429984-46430006 GGCAGTATGGTGGCGTGGACGGG + Intergenic
1040973622 8:53165022-53165044 CACAGCATGGTGAAGGGGAAGGG - Intergenic
1041694965 8:60726327-60726349 TCCAGAATGGGGAAGTGGAAAGG - Intronic
1043020134 8:74989950-74989972 TGCAGCAATGTGAATGGGACTGG + Intronic
1043527156 8:81109877-81109899 TGCAGCCTGGTTAGGAGGACAGG - Intronic
1047176648 8:122547539-122547561 TGTAGCATGCTGGAGTGGAAAGG - Intergenic
1049708811 8:144054623-144054645 TGCAGCATGGTGGAGTGGGGGGG + Exonic
1050075421 9:1857819-1857841 TGCATCATGGTGCAGTAGGCTGG - Intergenic
1051259036 9:15243850-15243872 GGCAGCACTGTGAAGTGCACAGG + Intronic
1053305952 9:36985094-36985116 GGCAGCATGATGCAGTGGAATGG - Intronic
1054724129 9:68633571-68633593 AGAAGTATGGTGAAGTGGTCAGG + Intergenic
1054907772 9:70425618-70425640 TGGAGCATGCTGCAGAGGACCGG - Intergenic
1057048080 9:91901074-91901096 TGAAGGATGGTGGAGTGGAGGGG - Intronic
1058002282 9:99878287-99878309 AGTAGCATGATGAAATGGACAGG + Intergenic
1058487652 9:105458284-105458306 TGCAGCTTGGTGAGCTGGCCAGG + Intronic
1059933582 9:119285141-119285163 TGCTGCAGTGTGGAGTGGACTGG + Intronic
1062247656 9:135577576-135577598 TGCAGCCTGGTGAAGAAGAGTGG - Intergenic
1203768351 EBV:38176-38198 AGAAGCATGGCGAAGTAGACAGG + Intergenic
1185647204 X:1624331-1624353 TGCAGCATGCTGAAGTACATGGG + Exonic
1193108689 X:77705420-77705442 TGCAGCAGGGAGACGTGGCCAGG - Intronic
1195179241 X:102340170-102340192 TGCAGCAGGGAGATGTGGCCAGG - Intergenic
1195860859 X:109381283-109381305 TGCAGCATGGTGTCATGGAAAGG + Intronic
1196806452 X:119591643-119591665 TGCTGGAAGGTGAAGTGGACTGG + Intronic
1197532122 X:127642281-127642303 GGAAGCTTGGTGAAGTGTACAGG + Intergenic
1201097471 Y:10632414-10632436 TGCAGCAGAGTGGAGTGGAGAGG - Intergenic
1201099909 Y:10663656-10663678 AGCAGCAGGGTGGAGTGGAGTGG - Intergenic
1201100575 Y:10668590-10668612 TGCAGCAGAGTGGAGTGGAGTGG - Intergenic
1201100904 Y:10672028-10672050 TGGAGCAGAGTGGAGTGGACTGG - Intergenic
1201112073 Y:10806840-10806862 TGGAGAAGGGTGAAGTGGAATGG - Intergenic
1201113625 Y:10819145-10819167 TGGAGTATGGTGGAGTGGAATGG - Intergenic
1201114230 Y:10823303-10823325 TGGAGCAGAGTGGAGTGGACTGG - Intergenic
1201118183 Y:10850699-10850721 TGCAGCATAGTGGAATGGAGTGG - Intergenic
1201124114 Y:10898397-10898419 TGGAGCATAGTGAAGAGGAGTGG - Intergenic
1201127421 Y:10927618-10927640 TGCAGCAGAGTGGAGTGGAGTGG - Intergenic
1201129745 Y:10943600-10943622 TGGAGCAGAGTGAAGTGGAACGG - Intergenic
1201130596 Y:10949102-10949124 TGGAGCATTGTGGAGTGGACTGG - Intergenic
1201583734 Y:15537726-15537748 AGCAGCATGGTAAAGGAGACAGG + Intergenic
1201929765 Y:19329539-19329561 GGCAGGATGATGAAGTTGACTGG - Intergenic
1202607939 Y:26654850-26654872 TGGAGCAGAGTGTAGTGGACTGG + Intergenic