ID: 1147566611

View in Genome Browser
Species Human (GRCh38)
Location 17:41540346-41540368
Sequence CTATATAAACTGCTGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147566611_1147566617 2 Left 1147566611 17:41540346-41540368 CCTACCTCCAGCAGTTTATATAG No data
Right 1147566617 17:41540371-41540393 CAGAAAACTGAGAGAGAGTGGGG No data
1147566611_1147566615 0 Left 1147566611 17:41540346-41540368 CCTACCTCCAGCAGTTTATATAG No data
Right 1147566615 17:41540369-41540391 GTCAGAAAACTGAGAGAGAGTGG No data
1147566611_1147566616 1 Left 1147566611 17:41540346-41540368 CCTACCTCCAGCAGTTTATATAG No data
Right 1147566616 17:41540370-41540392 TCAGAAAACTGAGAGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147566611 Original CRISPR CTATATAAACTGCTGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr