ID: 1147570836

View in Genome Browser
Species Human (GRCh38)
Location 17:41569854-41569876
Sequence AAGAAGAATCATAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147570836_1147570844 23 Left 1147570836 17:41569854-41569876 CCTACCTCCTTATGATTCTTCTT 0: 1
1: 0
2: 5
3: 27
4: 393
Right 1147570844 17:41569900-41569922 GAGTCTCATACTGCATCTCCAGG 0: 1
1: 0
2: 1
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147570836 Original CRISPR AAGAAGAATCATAAGGAGGT AGG (reversed) Exonic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
902413597 1:16226295-16226317 AAGAAGAAACATACAGAGATGGG - Intergenic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
906559071 1:46741309-46741331 AAGAAGAAAAATAGGGAGGAAGG - Intergenic
907572255 1:55494044-55494066 AATAATAATAATAAAGAGGTAGG - Intergenic
907956089 1:59229730-59229752 AAGAAGGATCAAAAAGAAGTGGG - Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
909169826 1:72281764-72281786 AAAAAGAGTTACAAGGAGGTGGG + Intronic
909431679 1:75595089-75595111 AAGAAGAAAGAAAGGGAGGTAGG + Intronic
909774491 1:79467054-79467076 AATCAGAATCTTAAAGAGGTGGG + Intergenic
910243140 1:85109924-85109946 AGGAAGAAAAAAAAGGAGGTGGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911258296 1:95657788-95657810 AAGAAGATCCATAGGTAGGTAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912344171 1:108948935-108948957 AATAAGAATCACAAGCAGGTGGG + Intronic
912687253 1:111777293-111777315 AAGAAGTAGGAAAAGGAGGTAGG + Intronic
912941779 1:114051423-114051445 AAGTGGAATCTCAAGGAGGTAGG + Intergenic
913530127 1:119727912-119727934 ATGATTATTCATAAGGAGGTGGG + Intronic
915665714 1:157442410-157442432 CATAAGAATCATAGGGAGATGGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915797640 1:158753441-158753463 AAGTAGAAGTAAAAGGAGGTTGG - Intergenic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
918231123 1:182533207-182533229 CAGAAAAATAATTAGGAGGTAGG - Intronic
918992333 1:191713300-191713322 GAGAAGAATCCTAGGGAGATTGG - Intergenic
919501239 1:198340765-198340787 AACAGGAATCTTAATGAGGTTGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
921013319 1:211163258-211163280 AAGATGGATCATTAGGAGGAGGG - Intergenic
922133579 1:222803187-222803209 AAGAAGAATGATAAAACGGTAGG - Intergenic
922805450 1:228384805-228384827 AAGAGGTATCCTAAGGAGGAAGG + Intergenic
922924746 1:229339300-229339322 ATCAAGAATCATAACGAGGCAGG + Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065860913 10:29871777-29871799 AAGATGAAGCAAAAGGAGCTGGG + Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066009886 10:31184854-31184876 AAGTAGAATCTTAATGAGATGGG + Intergenic
1066124421 10:32326141-32326163 AAGAGGAAGGATAAGGAAGTAGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068292733 10:55025546-55025568 CAGAAGAATTATAAGAATGTAGG - Intronic
1068771057 10:60821012-60821034 AAGAAAAATCACAAGGAAGGAGG + Intergenic
1068830220 10:61485420-61485442 AAGAAGAATCTGCAGGGGGTAGG + Intergenic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1071521443 10:86333725-86333747 GAAAAGAATCATAAGGAAGAGGG + Intronic
1071741922 10:88369205-88369227 AAGAAGAGTCATGGGGAGGGAGG - Intronic
1072723253 10:97793858-97793880 AGGAAGGATCTTAAAGAGGTTGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073262769 10:102203075-102203097 AAGAGGAATGATTAGGAGGGTGG - Intergenic
1073529982 10:104221997-104222019 AAAAAGAATCTAAAGTAGGTGGG - Intronic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074850188 10:117433164-117433186 AACAAGATTGATAGGGAGGTTGG + Intergenic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1076268423 10:129129503-129129525 ACCAAGAATCACAAGGACGTGGG - Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1079146661 11:17858300-17858322 AAGAAGAGTCATCAGAGGGTGGG + Intronic
1079967619 11:26997687-26997709 AATAAGAATCATGAGGAAGTGGG - Intergenic
1080165000 11:29225388-29225410 AAGAAGAGACAGAAAGAGGTGGG - Intergenic
1081262490 11:40977996-40978018 AAGAAGAATAAGAAGGAATTAGG - Intronic
1082120084 11:48370689-48370711 AAGAAGAATCAGTAGGGGCTGGG - Intergenic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086734088 11:90283932-90283954 GAGAAGGATTATGAGGAGGTTGG + Intergenic
1087556170 11:99723454-99723476 AAGCAGAGTCATCTGGAGGTTGG - Intronic
1088883703 11:113991128-113991150 AAGAAGAAACACTAGGAGGTGGG + Intergenic
1088924577 11:114287680-114287702 AAGAAGAAAAATAAGGTGGGAGG - Intronic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090637401 11:128698765-128698787 AAGAAAAATCATAAAGAATTTGG + Intronic
1092037193 12:5346764-5346786 ATGAAGAAACGTAAGCAGGTTGG + Intergenic
1092180484 12:6443440-6443462 CAGAAGAATCATGAGGAACTGGG - Intergenic
1093161428 12:15751753-15751775 AAGAAGGATACTAAGGAGGAGGG - Intronic
1093269738 12:17045389-17045411 CAAAAGAATAAAAAGGAGGTAGG + Intergenic
1094241141 12:28226182-28226204 ATGAAGATTCATTATGAGGTAGG + Exonic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1096127097 12:49128007-49128029 GAGAAGGATTATGAGGAGGTTGG - Exonic
1096134047 12:49185059-49185081 GAGAAGGATTATGAGGAGGTTGG - Exonic
1096145091 12:49273162-49273184 GAGAAGGATTATGAGGAGGTTGG + Exonic
1096793843 12:54061717-54061739 AGGAAGAACCAAAAGGTGGTGGG + Intergenic
1096980555 12:55726116-55726138 AAGGCGATCCATAAGGAGGTAGG - Exonic
1097323588 12:58251593-58251615 AGGAAAGATCATAAGTAGGTTGG - Intergenic
1097395010 12:59062386-59062408 AAGTAGAATTATAAGAAAGTGGG + Intergenic
1098491325 12:71083359-71083381 ATGATTATTCATAAGGAGGTGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1100029768 12:90171998-90172020 TAGAAGAATCAAAAGTAAGTTGG + Intergenic
1100619078 12:96254742-96254764 AAAAGGAATCCTAAGGAGGAAGG + Intronic
1100830364 12:98511648-98511670 AAAAAAAATCATCTGGAGGTGGG - Intergenic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103973847 12:124689178-124689200 AAGAGGAATCACAGAGAGGTGGG + Intergenic
1105032446 12:132893296-132893318 ATGAAGAATTATCATGAGGTAGG - Intronic
1105725374 13:23158501-23158523 AAGTAGAAACATAAAGATGTTGG - Intergenic
1106543120 13:30707589-30707611 ATGAAGAATCGTCAGAAGGTCGG - Intergenic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1106672182 13:31917931-31917953 AAGAAGAGTCACAGGGAGCTGGG + Intergenic
1108567879 13:51719146-51719168 ATAAAGCATCCTAAGGAGGTTGG - Intronic
1109106200 13:58253541-58253563 AAGAAGAAAAATGAGGAGGGAGG - Intergenic
1109648641 13:65294719-65294741 AGGAAGAATGATGAAGAGGTAGG - Intergenic
1109986525 13:69993492-69993514 ACGAAGAATGAAAAAGAGGTCGG + Intronic
1111166542 13:84464535-84464557 AAGAATAACTAAAAGGAGGTTGG + Intergenic
1111904114 13:94235699-94235721 TCAAAGAATCATTAGGAGGTAGG - Intronic
1112234894 13:97626424-97626446 AAGAAAAATCACAAGGAAATTGG - Intergenic
1112937808 13:104823019-104823041 AAGAAGTATCATAAGAATATAGG + Intergenic
1112955794 13:105056671-105056693 AAGAAGAGTCACAGGGAGGGTGG + Intergenic
1113093902 13:106643247-106643269 AAGTACAATCTTAAGCAGGTAGG + Intergenic
1113112339 13:106837038-106837060 AAGAGGAATGAGAAGAAGGTTGG + Intergenic
1113601202 13:111569453-111569475 AAGTAGCATCTTAAGAAGGTGGG + Intergenic
1114260604 14:21033580-21033602 AGGAAGGATGATGAGGAGGTGGG + Exonic
1115165577 14:30445246-30445268 AAGAAGAGTGCTAAAGAGGTTGG + Intergenic
1115617827 14:35113155-35113177 CAGAAGAAACATTAGGAGATGGG + Intronic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1116187205 14:41611555-41611577 AAGAACAAGCATAAGCAGATAGG + Intronic
1116213581 14:41979709-41979731 AAGAAGGAGCATAAGTAAGTAGG + Intergenic
1120387399 14:83863593-83863615 AGGAAGCATCATAAGGAGAATGG - Intergenic
1120791634 14:88589530-88589552 AAGAAGAAATATAAAGTGGTTGG - Intronic
1121193073 14:92046843-92046865 ATGAAGAATTATACTGAGGTAGG + Exonic
1121812645 14:96904949-96904971 AATAAGAATCCAAATGAGGTTGG + Intronic
1121895072 14:97639349-97639371 GAGAAGAATGAATAGGAGGTCGG + Intergenic
1123154220 14:106208914-106208936 AAGAAGAAACATCAGGAGTGAGG + Intergenic
1124509313 15:30309560-30309582 AAGAAGATTCATCAGAATGTAGG - Intergenic
1124577046 15:30919083-30919105 AAGGAAAATCATAAGGGGGCTGG + Intronic
1124577100 15:30919393-30919415 AAAAAAAATCATAAGGGGCTGGG + Intronic
1124647805 15:31452024-31452046 AATAACAATAAAAAGGAGGTAGG - Intergenic
1124734247 15:32229102-32229124 AAGAAGATTCATCAGAATGTAGG + Intergenic
1124831074 15:33150145-33150167 CAGAAGAATCACAGGGAGCTTGG - Intronic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1126343088 15:47665306-47665328 AAGAAGAATGAAAAGGAAGATGG - Intronic
1127943582 15:63726635-63726657 AAGAAGAAACATAAGATGGAAGG + Intronic
1127954643 15:63842760-63842782 AAAGATAATCATAAGGAGGCTGG + Intergenic
1128974644 15:72142065-72142087 AAGATGAATCGTAGGGAGTTAGG - Exonic
1130719153 15:86369852-86369874 AAACAGAATTACAAGGAGGTAGG + Intronic
1130773240 15:86946549-86946571 AAGAAATACCATGAGGAGGTTGG + Intronic
1131304886 15:91233646-91233668 AAGAAGACTCATCAGAATGTAGG - Intronic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131911271 15:97206186-97206208 AAGCATATTCATAAGGATGTTGG - Intergenic
1132219049 15:100091276-100091298 ATGAAGAATAATTATGAGGTAGG + Intronic
1133085256 16:3357357-3357379 AAGAAGAGACAAAAAGAGGTAGG - Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1134412945 16:14018407-14018429 AACTAAAATCATAAAGAGGTTGG - Intergenic
1134426347 16:14150550-14150572 AAGAAAAATCATAAGGAGCTGGG + Intronic
1134761859 16:16721520-16721542 TAGAAACCTCATAAGGAGGTGGG - Intergenic
1134769611 16:16795954-16795976 TGGAAGCATCATAAGGAGATAGG + Intergenic
1134984199 16:18637650-18637672 TAGAAACCTCATAAGGAGGTGGG + Intergenic
1135292015 16:21248002-21248024 AAGAAGAAAGAAAAGGATGTTGG - Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1137083942 16:36099457-36099479 AAGAAAAATGGTAAGCAGGTAGG + Intergenic
1137566346 16:49534970-49534992 AAGAAGAACCATAAAGAAATGGG - Intronic
1137740287 16:50764060-50764082 AGTATGAATCATGAGGAGGTTGG - Intronic
1138701037 16:58863901-58863923 CCAAAGATTCATAAGGAGGTAGG - Intergenic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1139120898 16:64015015-64015037 AAAAAGAATCAAAAGGTTGTGGG + Intergenic
1140062178 16:71580402-71580424 AAGAGGAATCATCAGGAGTAAGG + Intergenic
1140353191 16:74282208-74282230 AAGAGGAATAACAAGCAGGTAGG + Intergenic
1140653518 16:77115121-77115143 AGGAAGAGTCAGAAGTAGGTGGG - Intergenic
1141393290 16:83682288-83682310 ATGATTATTCATAAGGAGGTGGG + Intronic
1141484774 16:84331461-84331483 AGTAATAATCATAATGAGGTTGG - Intergenic
1142705706 17:1692639-1692661 AAGAAGAACTAAAAAGAGGTGGG - Intergenic
1144180951 17:12752285-12752307 AAGAAGTATAAAAAAGAGGTGGG + Intronic
1144289135 17:13808734-13808756 AAAAAAAATCATAAGGAGGAGGG - Intergenic
1147474869 17:40701135-40701157 AGGAAGAACCACGAGGAGGTAGG - Exonic
1147563872 17:41524838-41524860 AAGAAGAACCATGAGGAGGTGGG - Exonic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1148458677 17:47825030-47825052 AAAAAGAATCAGGATGAGGTTGG + Intronic
1149918732 17:60636296-60636318 AAGAACAATCATGAAGAAGTAGG - Intronic
1150420412 17:65029022-65029044 AATGAGAAACATAAGGATGTTGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1151197821 17:72444594-72444616 AAGTAGAATGATATGGGGGTGGG + Intergenic
1203164905 17_GL000205v2_random:84881-84903 AAGAACAATTTCAAGGAGGTGGG + Intergenic
1154473101 18:14723778-14723800 AATAATAATAATAAGGAGCTGGG - Intergenic
1155057578 18:22198365-22198387 AACAAGAAGCATAAGCAGGCTGG - Intronic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156592321 18:38504994-38505016 AAGAAGAAACAAAAGGAGAGGGG - Intergenic
1156833133 18:41519905-41519927 AAGAAGAACCTTAAGGAGACAGG - Intergenic
1157115020 18:44854403-44854425 AAGGAGAATCAAAAGGTGTTTGG - Intronic
1157130675 18:45004531-45004553 AACAAGAATTATAAGAATGTGGG + Intronic
1157636793 18:49165095-49165117 AACATTAATCATAAGGAAGTTGG + Intronic
1158079995 18:53578613-53578635 AAGATGAAAAATAAGGAGGCTGG + Intergenic
1158278764 18:55797607-55797629 AATATGAATCATAAGAAAGTTGG - Intergenic
1158430840 18:57385879-57385901 AAGAAGATGCATAGGGAGGCTGG + Intergenic
1159309806 18:66692157-66692179 AAAAAGAAACAAAAGGAGGGTGG - Intergenic
1159885583 18:73901263-73901285 AAGAAAAAGCAAAAGGAGCTTGG - Intergenic
1160047336 18:75399207-75399229 AAGAAGAAAGTCAAGGAGGTAGG + Intergenic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1163087805 19:14994823-14994845 AAGAAGAAAAATAAGCAGGCAGG + Intronic
1164241274 19:23391458-23391480 AACAAGATTAGTAAGGAGGTAGG - Intronic
1164597912 19:29542182-29542204 TAGAAGAATGATAAGTAGATGGG + Intronic
1165985396 19:39764425-39764447 ATGATTATTCATAAGGAGGTGGG + Intergenic
1166624436 19:44337186-44337208 AAGAAGAAACACAAGAAGGAAGG - Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
926190650 2:10724943-10724965 AAGAAAAATAATTAGGAGGCTGG - Intronic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
927874394 2:26645381-26645403 AGGCAGAATCATATGGAGGGAGG - Intergenic
929137518 2:38638803-38638825 AAGAAGGAAGAAAAGGAGGTAGG + Intergenic
929949682 2:46397493-46397515 AAAAAGAAACACAGGGAGGTTGG + Intergenic
930793069 2:55355443-55355465 AATGAGAAAAATAAGGAGGTTGG - Intronic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
931129519 2:59318465-59318487 AACAAGAAGAATAAGGAGGAGGG + Intergenic
931527455 2:63172519-63172541 AAAAATAATAATAAAGAGGTAGG + Intronic
936936889 2:117847593-117847615 TACAAGAATCATGATGAGGTAGG - Intergenic
937009206 2:118546544-118546566 AAGAGGAGTCATAAGCAGGAGGG - Intergenic
937357289 2:121206004-121206026 AAGAAGAATCTGGAGGAGGTGGG + Intergenic
938023235 2:127923275-127923297 AATAAGAATCTTAAGCAGGCTGG - Intergenic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
940035979 2:149312393-149312415 CACAAGAATCATAAGGGAGTTGG + Intergenic
942151980 2:173085404-173085426 AAGTGGAAACATAAGAAGGTAGG - Intronic
942337294 2:174902750-174902772 AAGAAGGATCAAAAGGAACTGGG - Intronic
943561794 2:189472920-189472942 AAGAAATATCATAAGGAGGCCGG + Intronic
945735319 2:213591747-213591769 AAGAAGAAACATGAGGAGTAAGG + Intronic
945915110 2:215695561-215695583 AAGAAGACTGATAAAGAGGCAGG + Intergenic
946366150 2:219250392-219250414 GAGAAGGATTATGAGGAGGTGGG - Exonic
946369511 2:219272073-219272095 GAGAAGGATTACAAGGAGGTGGG + Intronic
946737549 2:222769611-222769633 ACGATCATTCATAAGGAGGTGGG - Intergenic
947159705 2:227200131-227200153 AAGAAATATCATAAGATGGTGGG - Intronic
947245792 2:228046905-228046927 ATGTGGAATCATAATGAGGTTGG - Intronic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
948498906 2:238376438-238376460 AAGAAGAGGCATAAGGCGGCAGG - Intronic
948967365 2:241393314-241393336 ACTAAGAACCATAAGGAGGCCGG - Intronic
1169717322 20:8634873-8634895 TAGAAGAATCACAAGTAGTTAGG - Intronic
1170813863 20:19696729-19696751 CAGAAGAATCATGGGCAGGTGGG + Intronic
1174984575 20:55436295-55436317 AAGAAGAAGTTTAAGAAGGTGGG - Intergenic
1176406844 21:6374206-6374228 AAGAACAATTTCAAGGAGGTGGG - Intergenic
1176801380 21:13434071-13434093 AATAATAATAATAAGGAGCTGGG + Intergenic
1177193206 21:17874608-17874630 AAGAAGAATCATTAGAATGTAGG + Intergenic
1177483726 21:21728154-21728176 AAGAAGACCCACAAGGAGATTGG + Intergenic
1178170016 21:30030159-30030181 AAGAAGAATAGAAGGGAGGTTGG + Intergenic
1179968498 21:44820062-44820084 AAGAAGACTCATGAGAAGGCAGG + Intergenic
1180371251 22:12039292-12039314 AATAAAAATAAGAAGGAGGTTGG + Intergenic
1182546979 22:31082136-31082158 AAGATGAATCAACAGGAGGTGGG + Intronic
1184110339 22:42390408-42390430 AAGAAGGAAGATAGGGAGGTTGG + Intronic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
951219154 3:20051288-20051310 AGGTAGAATGATAAGGAGGTGGG + Intronic
951824999 3:26859056-26859078 AGGAAGAATCACTAGGAGGAAGG + Intergenic
952110201 3:30114135-30114157 AAGGAGAATAATATGGAGCTTGG - Intergenic
952347970 3:32506259-32506281 ATGATTATTCATAAGGAGGTGGG + Intergenic
952623623 3:35376869-35376891 AAGAAGGAGAATAAGGACGTGGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952710214 3:36423867-36423889 AAGAAGAAAGATGAGGAGGAAGG - Intronic
953588114 3:44223419-44223441 AAGCTGAATCATAGGGCGGTGGG + Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
954946618 3:54431041-54431063 AAGAAAAATCATAAGGGGCCTGG + Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955551619 3:60091296-60091318 AAGAAGATTTATAAAGAGGAAGG + Intronic
956307826 3:67845822-67845844 TAGAAGAATAATAAAGAGTTTGG - Intergenic
957163399 3:76639647-76639669 AAGAAGAATCATGCAGAGGTTGG + Intronic
957304169 3:78435037-78435059 AAGAAGAATCATAATGATGATGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958415554 3:93869034-93869056 AAAAAGAAGGATAGGGAGGTAGG - Intergenic
958643113 3:96834414-96834436 AAGAAGAATTAGAAGTAAGTAGG + Intronic
960243300 3:115371180-115371202 AAGAAGAAAAGGAAGGAGGTAGG - Intergenic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
960835160 3:121898243-121898265 AAGAAGATCCTAAAGGAGGTGGG - Intronic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
962733740 3:138305588-138305610 AAGAAGACTCCCAAGCAGGTGGG + Intronic
964106570 3:153046637-153046659 AAGAAAAACCAAAAGCAGGTCGG - Intergenic
964721154 3:159768295-159768317 AAGAAGACTCATAAGTAAGGGGG - Intronic
964977590 3:162638795-162638817 ATGAAGAAACATAATGAAGTTGG - Intergenic
966632766 3:182096783-182096805 TAAAAGAATCATCAGGAGGCTGG - Intergenic
966718679 3:183039393-183039415 AAGAAGATTCAGAAGAAGATAGG - Intronic
966896972 3:184452480-184452502 AAGAAGACTCATAAGAATTTCGG + Intronic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
970110720 4:12635176-12635198 AAGAAGAAACATGAGGGGTTAGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970994580 4:22250642-22250664 AAGAATAACCAGAAGCAGGTTGG - Intergenic
971228194 4:24774699-24774721 AAGAACTTTCATAAGTAGGTTGG - Intergenic
972138429 4:35923756-35923778 AAGAAGAATGATCTGAAGGTTGG - Intergenic
972356561 4:38284590-38284612 GAGAAGAGTTATAAGCAGGTTGG + Intergenic
973299154 4:48560432-48560454 AGGAAGAATGACAAGGTGGTGGG + Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974189435 4:58485237-58485259 AACATGAATCAAAAGAAGGTGGG - Intergenic
975525728 4:75348309-75348331 AAGAAGAATCAGAAATGGGTGGG + Intergenic
976128558 4:81858984-81859006 AAGAAGAAAGAACAGGAGGTAGG + Intronic
976576710 4:86680742-86680764 AAGAGGAGTCATAAGGTAGTTGG - Intronic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
979646228 4:123073214-123073236 AAGAAGAAAGAAAAGGAGATAGG - Intronic
980793526 4:137651092-137651114 AAGAAGAAGCCTGTGGAGGTCGG + Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
980951728 4:139385762-139385784 AAGCAGAATAATGTGGAGGTTGG - Intronic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
982635397 4:157889391-157889413 AAGAAGAACCATCAGAAAGTAGG + Intergenic
982922073 4:161288368-161288390 AAGAAAAATCAAAAAGAGGCCGG + Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
985006579 4:185540488-185540510 AGGAAGAAAGAAAAGGAGGTAGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
988468969 5:31519035-31519057 AAGAAGAAACATTGGGAGTTTGG - Intronic
988629009 5:32909456-32909478 TGGAAGAATCATGAGGAGCTTGG - Intergenic
989604571 5:43231861-43231883 GAGAAGGATTATAAGGAGGTTGG - Intronic
989760053 5:45004075-45004097 AAGAAAAATAATGAGGAGTTTGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
990276398 5:54201594-54201616 AAGAAGAAGCATAAGGGGTAAGG - Intronic
990895705 5:60698655-60698677 AAAAAAAATAATAAGGAGATTGG - Intronic
990924222 5:61001245-61001267 AAGTAAAAGTATAAGGAGGTTGG - Intronic
991050588 5:62268638-62268660 GAGAAGAATTAGAAGTAGGTAGG + Intergenic
993651478 5:90528308-90528330 AACAAGACACATAAGTAGGTCGG - Intronic
994901115 5:105770688-105770710 AAGAAAATTCAAAAGTAGGTTGG + Intergenic
997434963 5:133867356-133867378 AAGAAAAATCATAGGGGTGTTGG - Intergenic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997762159 5:136459934-136459956 AAAAAGATTGATAAGGAAGTAGG - Intergenic
997763360 5:136472518-136472540 AAGAAGAATCAAAAGGAGATGGG - Intergenic
998407643 5:141883061-141883083 AAGAAGGATTTTAAGGGGGTGGG - Intergenic
998674293 5:144389748-144389770 AAGAAGAATCATAAGAAGTATGG + Intronic
998788314 5:145737224-145737246 AAGAAGAAGCATAGGGTGCTAGG + Intronic
999028253 5:148259900-148259922 ATAAACAATTATAAGGAGGTTGG - Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999543154 5:152596798-152596820 GAGAAGAAACATAAGCAAGTTGG + Intergenic
999798288 5:155008504-155008526 AAGTAGAATAATAAGGTGCTGGG - Intergenic
1000594136 5:163194476-163194498 AAGAAGAAGCATTAGGAGTAAGG - Intergenic
1000622005 5:163496422-163496444 ATGATTAATCATAAGGGGGTGGG - Intergenic
1002938938 6:1699265-1699287 AAGAAGAAAAATAAGGAAGATGG + Intronic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1005211840 6:23474629-23474651 AAGAGGAATGATTGGGAGGTAGG + Intergenic
1005437957 6:25835605-25835627 AACAAAAATAGTAAGGAGGTTGG + Intronic
1005662477 6:28013203-28013225 AAGAACAATCAGAAGCAGTTTGG - Intergenic
1006035856 6:31211515-31211537 ATGATTATTCATAAGGAGGTGGG - Intergenic
1006226422 6:32540723-32540745 AAGAAAAATCATCAGAAGCTAGG - Intergenic
1007048946 6:38806237-38806259 AAAAAGAATGAAAAGAAGGTGGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007514305 6:42399218-42399240 AACAAAAATCAGAAGGAAGTAGG + Intronic
1008101701 6:47398684-47398706 AGGAAGAGTCATAGGGAGATAGG - Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008884181 6:56413643-56413665 AAGAAGATTAAGGAGGAGGTGGG + Intergenic
1009441247 6:63681492-63681514 AAGAAAAATTACAAAGAGGTAGG - Intronic
1010156735 6:72802945-72802967 TGGAAGAATCATAAGGAAATAGG - Intronic
1011085723 6:83538260-83538282 AAGATGAACCACAAGGATGTTGG + Intergenic
1011524565 6:88249946-88249968 AAGAAAATTCATAGGGAAGTAGG + Intergenic
1012040214 6:94194765-94194787 AGGAAGATTGAGAAGGAGGTAGG - Intergenic
1012137382 6:95575919-95575941 GACAAGAATCATTAGGAGGAGGG + Intergenic
1012865092 6:104609364-104609386 AAGTGGAATTATAAGGGGGTTGG - Intergenic
1013434239 6:110085732-110085754 AAAAAGAATCAAAAGGAGCTTGG + Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1014871766 6:126604544-126604566 ATGATGGATTATAAGGAGGTAGG - Intergenic
1014980357 6:127938863-127938885 AAGATGACTCATCAGGAGGAAGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015092922 6:129380296-129380318 AAGAAGAATGGTAATAAGGTTGG + Intronic
1015671847 6:135699696-135699718 AAAAAAAATAATAAGCAGGTGGG + Intergenic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1020126150 7:5533404-5533426 AATAATAATAAAAAGGAGGTTGG - Intronic
1020522472 7:9209652-9209674 AAGAATAATCAGAATGAGATAGG - Intergenic
1020914970 7:14181604-14181626 AAGAAGAATCATAGATAGGAAGG + Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1024954504 7:54902449-54902471 ATGAATAATCATAAAGAAGTAGG + Intergenic
1026148683 7:67770199-67770221 AAGAAGAAACATAAGAAGGATGG - Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1027735123 7:81922337-81922359 AAGAGGAATCATAAGAAAGAGGG - Intergenic
1028152247 7:87387653-87387675 AAGAAAAATCATAAGGAGGCTGG + Intronic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028981718 7:96974492-96974514 GGGAAGAAATATAAGGAGGTAGG + Intergenic
1029641143 7:101820323-101820345 ATGAAGAATCCTACAGAGGTAGG + Intronic
1029698724 7:102232038-102232060 AAAAAAAATCATAAGGACTTGGG + Intronic
1031050608 7:116941265-116941287 AAAAAGAAAAAAAAGGAGGTGGG - Intergenic
1031454576 7:121963474-121963496 AAGATGATTCATAAGGAGGTGGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032411812 7:131699738-131699760 AGGTAGAAGCATAAGGATGTGGG + Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033405445 7:141068503-141068525 AAGAAGATTAATATGGTGGTGGG + Intergenic
1033861231 7:145630618-145630640 AGGAAGAATCAGAAGAAGCTGGG - Intergenic
1034310504 7:150083658-150083680 AAAAGGAATCATCAAGAGGTTGG - Intergenic
1034571186 7:151957987-151958009 AATAAGAAAATTAAGGAGGTTGG + Intronic
1034796335 7:154016972-154016994 AAAAGGAATCATCAAGAGGTTGG + Intronic
1037008911 8:13817055-13817077 AAAGAGAATGATATGGAGGTGGG + Intergenic
1037123852 8:15321096-15321118 AAGAAAAGGCATAAGGAAGTGGG - Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037931581 8:22883590-22883612 AAGACGACTCATTAGCAGGTTGG - Intronic
1037980128 8:23247141-23247163 AAGAAGGAAAATAAGGAGGCTGG + Intronic
1038605798 8:29002471-29002493 CAGAAGGATCATTTGGAGGTTGG + Intronic
1038812944 8:30869716-30869738 AAGTAGACTCACAAGGAGATAGG - Intronic
1040546814 8:48404475-48404497 AAGTAGAATCGTAAGAAGTTTGG + Intergenic
1041038445 8:53820312-53820334 AAGAAGCATCTTTAGGAGATTGG + Intronic
1041201714 8:55455817-55455839 AAGATCAGTCATCAGGAGGTAGG + Intronic
1041399014 8:57421304-57421326 TACATGATTCATAAGGAGGTGGG + Intergenic
1042978443 8:74498159-74498181 AAGAAGAATCAAAATGACTTAGG - Intergenic
1043839092 8:85080703-85080725 AACACTAATCATAAGAAGGTAGG - Intergenic
1044784035 8:95775839-95775861 AAAAATAATAATGAGGAGGTTGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046353180 8:113042952-113042974 AAGAAGAATATTTAGGAAGTAGG - Intronic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048573120 8:135671142-135671164 GAGAAGACTCAGCAGGAGGTGGG + Intergenic
1049065029 8:140306512-140306534 AAGAAGAATTATATGGAGCAAGG + Intronic
1050137945 9:2487759-2487781 AATGAGAATCATAGGAAGGTGGG - Intergenic
1051183564 9:14436687-14436709 AAAAAGAATAATCAGGTGGTAGG - Intergenic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1052019747 9:23512043-23512065 GAGAAGAGGCGTAAGGAGGTAGG - Intergenic
1052200557 9:25773767-25773789 ATGATTAATCATAAGGAGGTGGG + Intergenic
1052587574 9:30448928-30448950 AATAAAAATCAAAAGAAGGTGGG + Intergenic
1052725225 9:32221144-32221166 AAGAAGAATCCTACAGAGGGGGG + Intergenic
1055227035 9:74011224-74011246 AAGATGATGCATAAGGAGGGAGG - Intergenic
1055652025 9:78415499-78415521 AAATAGAATCATGAGGAGGATGG + Intergenic
1055720060 9:79163409-79163431 ATAAAGAATCACTAGGAGGTAGG - Intergenic
1056524058 9:87426348-87426370 AAGATGGATCATCACGAGGTTGG + Intergenic
1057291841 9:93811839-93811861 CAGAAAATTCATCAGGAGGTGGG + Intergenic
1057294849 9:93828827-93828849 AAGAAGGATCATCAGGACATTGG - Intergenic
1057553360 9:96068210-96068232 AAGAAAAATCATAGTGAGATGGG + Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1060223696 9:121777939-121777961 AACACGAATCAAAAGGAAGTTGG - Intronic
1060799426 9:126534363-126534385 AAGAAAATTCATTAGGAAGTAGG - Intergenic
1203444238 Un_GL000219v1:40186-40208 AAGAACAATTTTAAGGAGCTGGG + Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1186006649 X:5079478-5079500 ATGATGATTCATAAGGAGATGGG - Intergenic
1187675164 X:21709332-21709354 ATGGAGAATCATGGGGAGGTTGG - Intronic
1188918461 X:35941585-35941607 AATCAGGATCATAAGGAGGAAGG - Intronic
1189834292 X:45005026-45005048 AAGAGGTACCATAAGGAGGGGGG - Intronic
1190668053 X:52713495-52713517 AAGAAGAAGAATAAGGTGGGAGG - Intergenic
1190671364 X:52744909-52744931 AAGAAGAAGAATAAGGTGGGAGG + Intergenic
1192208486 X:69111411-69111433 AGGAAGAAACAAAAGGATGTGGG + Intergenic
1192459899 X:71308049-71308071 AAGGAAAATCATAAGGGGCTGGG + Intergenic
1193542248 X:82787054-82787076 AAGAAGACTCATAAGAATTTAGG - Intergenic
1193632350 X:83905479-83905501 AAGAAGACTCATCAGGATCTAGG + Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194430285 X:93795075-93795097 AAGAAAGATCAGAAGGAGCTGGG + Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1197484074 X:127025275-127025297 ATGATTATTCATAAGGAGGTGGG - Intergenic
1198333948 X:135649185-135649207 ATGAATATTCATAAGGAGGTGGG - Intergenic
1198363718 X:135920715-135920737 ATGATTATTCATAAGGAGGTGGG + Intergenic
1198381770 X:136090808-136090830 AAGAAGAACAATAAGGTGGGAGG + Intergenic
1198852541 X:140980497-140980519 AAGAAGAATAATGAAGAGGAAGG - Intergenic
1198910750 X:141611184-141611206 AATAATAATAATAAGGAGGTAGG - Intronic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic