ID: 1147572104

View in Genome Browser
Species Human (GRCh38)
Location 17:41577663-41577685
Sequence CTGTGTGGCTAAAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147572094_1147572104 19 Left 1147572094 17:41577621-41577643 CCTGAGGTGGGAACAAGCAAAGT No data
Right 1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG No data
1147572099_1147572104 -9 Left 1147572099 17:41577649-41577671 CCAGGGCAGGAGTCCTGTGTGGC No data
Right 1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147572104 Original CRISPR CTGTGTGGCTAAAGGGCAGT GGG Intergenic
No off target data available for this crispr