ID: 1147574149

View in Genome Browser
Species Human (GRCh38)
Location 17:41588950-41588972
Sequence CCCTCGGAGGAGGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147574149_1147574159 -2 Left 1147574149 17:41588950-41588972 CCTTCCTCCCCCTCCTCCGAGGG No data
Right 1147574159 17:41588971-41588993 GGGAATCCAAAAGATAAAGATGG No data
1147574149_1147574160 2 Left 1147574149 17:41588950-41588972 CCTTCCTCCCCCTCCTCCGAGGG No data
Right 1147574160 17:41588975-41588997 ATCCAAAAGATAAAGATGGCAGG No data
1147574149_1147574161 3 Left 1147574149 17:41588950-41588972 CCTTCCTCCCCCTCCTCCGAGGG No data
Right 1147574161 17:41588976-41588998 TCCAAAAGATAAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147574149 Original CRISPR CCCTCGGAGGAGGGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr