ID: 1147581948

View in Genome Browser
Species Human (GRCh38)
Location 17:41631984-41632006
Sequence CCGAGCAAGGAGATGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147581948_1147581960 -10 Left 1147581948 17:41631984-41632006 CCAGCCCCCATCTCCTTGCTCGG No data
Right 1147581960 17:41631997-41632019 CCTTGCTCGGGAGGCTTTGGGGG No data
1147581948_1147581962 1 Left 1147581948 17:41631984-41632006 CCAGCCCCCATCTCCTTGCTCGG No data
Right 1147581962 17:41632008-41632030 AGGCTTTGGGGGCACAGCGAGGG No data
1147581948_1147581963 5 Left 1147581948 17:41631984-41632006 CCAGCCCCCATCTCCTTGCTCGG No data
Right 1147581963 17:41632012-41632034 TTTGGGGGCACAGCGAGGGTCGG No data
1147581948_1147581961 0 Left 1147581948 17:41631984-41632006 CCAGCCCCCATCTCCTTGCTCGG No data
Right 1147581961 17:41632007-41632029 GAGGCTTTGGGGGCACAGCGAGG No data
1147581948_1147581964 19 Left 1147581948 17:41631984-41632006 CCAGCCCCCATCTCCTTGCTCGG No data
Right 1147581964 17:41632026-41632048 GAGGGTCGGCTGTGAAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147581948 Original CRISPR CCGAGCAAGGAGATGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr