ID: 1147583270

View in Genome Browser
Species Human (GRCh38)
Location 17:41638591-41638613
Sequence CTGGGTATACAGGGGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147583270_1147583288 14 Left 1147583270 17:41638591-41638613 CCCAGCACCCCCTGTATACCCAG No data
Right 1147583288 17:41638628-41638650 CTCCCCTACCCAGGGGTAAGTGG No data
1147583270_1147583284 5 Left 1147583270 17:41638591-41638613 CCCAGCACCCCCTGTATACCCAG No data
Right 1147583284 17:41638619-41638641 GGCCAGGGGCTCCCCTACCCAGG No data
1147583270_1147583280 -10 Left 1147583270 17:41638591-41638613 CCCAGCACCCCCTGTATACCCAG No data
Right 1147583280 17:41638604-41638626 GTATACCCAGGGCTTGGCCAGGG No data
1147583270_1147583285 6 Left 1147583270 17:41638591-41638613 CCCAGCACCCCCTGTATACCCAG No data
Right 1147583285 17:41638620-41638642 GCCAGGGGCTCCCCTACCCAGGG No data
1147583270_1147583281 -9 Left 1147583270 17:41638591-41638613 CCCAGCACCCCCTGTATACCCAG No data
Right 1147583281 17:41638605-41638627 TATACCCAGGGCTTGGCCAGGGG No data
1147583270_1147583287 7 Left 1147583270 17:41638591-41638613 CCCAGCACCCCCTGTATACCCAG No data
Right 1147583287 17:41638621-41638643 CCAGGGGCTCCCCTACCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147583270 Original CRISPR CTGGGTATACAGGGGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr