ID: 1147586588

View in Genome Browser
Species Human (GRCh38)
Location 17:41656721-41656743
Sequence GTGTTCCTTGTGGCACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147586588_1147586598 7 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586598 17:41656751-41656773 TGGGCCTTCCATGGGGAGGGAGG No data
1147586588_1147586602 16 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586602 17:41656760-41656782 CATGGGGAGGGAGGAAGGTGAGG No data
1147586588_1147586595 0 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586595 17:41656744-41656766 AGGAGTGTGGGCCTTCCATGGGG No data
1147586588_1147586603 27 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586603 17:41656771-41656793 AGGAAGGTGAGGCCAAAAGATGG No data
1147586588_1147586597 4 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586597 17:41656748-41656770 GTGTGGGCCTTCCATGGGGAGGG No data
1147586588_1147586593 -2 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586593 17:41656742-41656764 ACAGGAGTGTGGGCCTTCCATGG No data
1147586588_1147586604 30 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586604 17:41656774-41656796 AAGGTGAGGCCAAAAGATGGCGG No data
1147586588_1147586596 3 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586596 17:41656747-41656769 AGTGTGGGCCTTCCATGGGGAGG No data
1147586588_1147586600 11 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG No data
1147586588_1147586594 -1 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586594 17:41656743-41656765 CAGGAGTGTGGGCCTTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147586588 Original CRISPR GTGTTCCTTGTGGCACTGCC TGG (reversed) Intergenic
No off target data available for this crispr