ID: 1147586590

View in Genome Browser
Species Human (GRCh38)
Location 17:41656731-41656753
Sequence CCACACTCCTGTGTTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147586590_1147586595 -10 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586595 17:41656744-41656766 AGGAGTGTGGGCCTTCCATGGGG No data
1147586590_1147586604 20 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586604 17:41656774-41656796 AAGGTGAGGCCAAAAGATGGCGG No data
1147586590_1147586600 1 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG No data
1147586590_1147586606 22 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586606 17:41656776-41656798 GGTGAGGCCAAAAGATGGCGGGG No data
1147586590_1147586607 26 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586607 17:41656780-41656802 AGGCCAAAAGATGGCGGGGCAGG No data
1147586590_1147586596 -7 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586596 17:41656747-41656769 AGTGTGGGCCTTCCATGGGGAGG No data
1147586590_1147586597 -6 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586597 17:41656748-41656770 GTGTGGGCCTTCCATGGGGAGGG No data
1147586590_1147586598 -3 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586598 17:41656751-41656773 TGGGCCTTCCATGGGGAGGGAGG No data
1147586590_1147586609 28 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586609 17:41656782-41656804 GCCAAAAGATGGCGGGGCAGGGG No data
1147586590_1147586608 27 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586608 17:41656781-41656803 GGCCAAAAGATGGCGGGGCAGGG No data
1147586590_1147586605 21 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586605 17:41656775-41656797 AGGTGAGGCCAAAAGATGGCGGG No data
1147586590_1147586603 17 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586603 17:41656771-41656793 AGGAAGGTGAGGCCAAAAGATGG No data
1147586590_1147586602 6 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586602 17:41656760-41656782 CATGGGGAGGGAGGAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147586590 Original CRISPR CCACACTCCTGTGTTCCTTG TGG (reversed) Intergenic
No off target data available for this crispr