ID: 1147586600

View in Genome Browser
Species Human (GRCh38)
Location 17:41656755-41656777
Sequence CCTTCCATGGGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147586588_1147586600 11 Left 1147586588 17:41656721-41656743 CCAGGCAGTGCCACAAGGAACAC No data
Right 1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG No data
1147586590_1147586600 1 Left 1147586590 17:41656731-41656753 CCACAAGGAACACAGGAGTGTGG No data
Right 1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147586600 Original CRISPR CCTTCCATGGGGAGGGAGGA AGG Intergenic
No off target data available for this crispr