ID: 1147588720

View in Genome Browser
Species Human (GRCh38)
Location 17:41667540-41667562
Sequence CAGCCTGAGCAAAGGCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147588715_1147588720 -9 Left 1147588715 17:41667526-41667548 CCAGGCGGAGAGACCAGCCTGAG No data
Right 1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147588720 Original CRISPR CAGCCTGAGCAAAGGCACAG GGG Intergenic
No off target data available for this crispr