ID: 1147589450

View in Genome Browser
Species Human (GRCh38)
Location 17:41672313-41672335
Sequence TTTACTTACATAGAAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147589450_1147589453 3 Left 1147589450 17:41672313-41672335 CCCTGGGTTTCTATGTAAGTAAA No data
Right 1147589453 17:41672339-41672361 AAACCCATCTCAGTATAGATGGG No data
1147589450_1147589452 2 Left 1147589450 17:41672313-41672335 CCCTGGGTTTCTATGTAAGTAAA No data
Right 1147589452 17:41672338-41672360 AAAACCCATCTCAGTATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147589450 Original CRISPR TTTACTTACATAGAAACCCA GGG (reversed) Intergenic
No off target data available for this crispr