ID: 1147591774

View in Genome Browser
Species Human (GRCh38)
Location 17:41688676-41688698
Sequence GACTCTAGGAGAGCTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147591774 Original CRISPR GACTCTAGGAGAGCTGGGAG GGG (reversed) Intergenic
901012514 1:6209664-6209686 GTTGCTAGGAGAGCTGGGAGGGG + Intronic
901461590 1:9395126-9395148 GACTCCAGAAGTGCTGGAAGCGG + Intergenic
901977282 1:13005199-13005221 TTCTCTAGCAGAGCTCGGAGGGG - Intronic
902004804 1:13223735-13223757 TTCTCTAGCAGAGCTCGGAGGGG + Intergenic
902024024 1:13369470-13369492 TTCTCTAGCAGAGCTCGGAGGGG + Exonic
902323527 1:15684165-15684187 GACTTGAGGAGGGCTGGGGGCGG + Intergenic
902987145 1:20161821-20161843 GATTCTTGGAGAGCTGAGATGGG - Intronic
903146381 1:21375353-21375375 AACTCTAGGACTGCAGGGAGCGG - Intergenic
904291911 1:29491895-29491917 GGGTCTAGGGGAGCTGGGGGAGG - Intergenic
904603855 1:31688538-31688560 GAGCCTTGGAGAGGTGGGAGTGG - Intronic
905004205 1:34697242-34697264 GACTATAGGAGTGCTGTGAGGGG - Intergenic
906535419 1:46548545-46548567 GACCCTGGGAGAGATGGGAGAGG + Intronic
906703459 1:47876689-47876711 GCCTCCAGCAGTGCTGGGAGGGG + Intronic
906813052 1:48849016-48849038 GGCTCCAGGTGGGCTGGGAGGGG + Intronic
907308341 1:53525809-53525831 GATGCGAGGAGAGCTTGGAGAGG - Intronic
911245844 1:95516324-95516346 AACTCTAGGAATGCTGGGACTGG + Intergenic
912681840 1:111733859-111733881 GATTCTGGCTGAGCTGGGAGAGG - Intronic
914680024 1:149932613-149932635 GTCTGTGGGAGAGGTGGGAGAGG + Intronic
914827247 1:151145272-151145294 GAGTCTAGGAGAGCTGTGGAAGG + Intronic
915463544 1:156082929-156082951 GACTCTGGGAGAGCGGGAGGGGG - Intronic
916138691 1:161675247-161675269 TATCCTGGGAGAGCTGGGAGGGG - Exonic
916394034 1:164365740-164365762 TACTGTAGAAGAGCTGGGAAAGG + Intergenic
917545529 1:175962761-175962783 GACTCTAGGTGCCCAGGGAGGGG - Intronic
919920657 1:202164706-202164728 GGCTGTGGGAGAGCAGGGAGGGG + Intergenic
920600698 1:207321490-207321512 GACTCGGGGAGAGTGGGGAGGGG - Intronic
920694964 1:208174994-208175016 GCCTCTGGGGGAGCTGGGACAGG + Intronic
922237260 1:223731473-223731495 GACTGTAGGAGGGCTGGGGTGGG - Intronic
922252304 1:223860631-223860653 TACTCTAGCTCAGCTGGGAGAGG + Intergenic
924544813 1:245016484-245016506 GACACGAGGAGTGCTGGGCGTGG - Intronic
1063146370 10:3298492-3298514 GACTGTTGGAGAGATGGGGGAGG + Intergenic
1063731176 10:8698888-8698910 GAATGTAGGAGAGTAGGGAGTGG - Intergenic
1066780800 10:38942916-38942938 GACGCTAGTAGAGCTGGCAGCGG - Intergenic
1067228160 10:44388808-44388830 GACTGCACGGGAGCTGGGAGAGG - Intergenic
1068455286 10:57247203-57247225 AGCAGTAGGAGAGCTGGGAGGGG - Intergenic
1069738673 10:70673802-70673824 GGCTCAAGGAGAGCTGCGTGAGG + Intronic
1070626324 10:78053814-78053836 GACTCTTTGAGGGCTGGAAGTGG + Intronic
1070753847 10:78979561-78979583 GAGTCAGGGAGAGCTTGGAGGGG - Intergenic
1070813347 10:79309366-79309388 CACCCTGGGAGAGCAGGGAGGGG - Intronic
1072158382 10:92744246-92744268 GAGTACAGGAGAGCTGAGAGAGG - Intergenic
1074346292 10:112689454-112689476 GACTCCAGGAGACATGGGTGGGG + Intronic
1075498844 10:122953944-122953966 GCTTCTAGGGGAGCTGTGAGGGG - Intronic
1075659042 10:124180702-124180724 GACACTAGAAGAGTTTGGAGGGG + Intergenic
1075808134 10:125204787-125204809 GACAGTAGGAGAGTGGGGAGGGG + Intergenic
1076752504 10:132550651-132550673 CACTGTAGGACAGCTGGGAGTGG + Intronic
1077452299 11:2655695-2655717 GCATCTAGGAGAGCATGGAGGGG - Intronic
1077967704 11:7153347-7153369 GACTCTGGCAGAGCTGCCAGAGG - Intergenic
1078397709 11:10996030-10996052 CTCTCTCTGAGAGCTGGGAGAGG + Intergenic
1079244367 11:18742252-18742274 GTCTGCAGGAGAGGTGGGAGGGG - Exonic
1080049694 11:27847007-27847029 GAATCCAGTTGAGCTGGGAGTGG - Intergenic
1080892228 11:36418981-36419003 AATTCTAGCAGAGCTGGTAGGGG - Intronic
1081623723 11:44634582-44634604 CACTCTTGGTGTGCTGGGAGGGG - Intergenic
1083731161 11:64653475-64653497 GAGCCAAGGAGAGCTGGGGGAGG - Intronic
1083777715 11:64902374-64902396 GACTCTCCGAGAGCTGGGCCAGG + Exonic
1083804676 11:65066739-65066761 CCCTCTAGGAGAGCTGGGCTGGG + Intronic
1083853335 11:65380107-65380129 GAGTTTAGGAGAGCTGCCAGAGG - Intronic
1084461002 11:69296540-69296562 GAGGGTAGGAGAGTTGGGAGAGG - Exonic
1084725848 11:70941493-70941515 GAATTTGGGAGAGTTGGGAGGGG - Intronic
1084968494 11:72756648-72756670 GACACCAGGAGACCTGGGACAGG + Intronic
1085011651 11:73145470-73145492 GACTCTAGGGGACCAGGGAAGGG + Intergenic
1085260688 11:75203098-75203120 CGCTCTAGGAGAGCTGGGCCAGG - Intronic
1089376724 11:117999888-117999910 GACTCTGGCAGAGCTGAGAAGGG + Exonic
1089696116 11:120217246-120217268 GCCTCTTGGGGAGCTGGGTGAGG + Intronic
1089781139 11:120874056-120874078 GGGCCGAGGAGAGCTGGGAGAGG - Exonic
1089929633 11:122297339-122297361 GACTCAAAGAGAGGAGGGAGAGG + Intergenic
1092039245 12:5369021-5369043 GATTCTAGAAGACCAGGGAGAGG - Intergenic
1092951152 12:13504778-13504800 GACCCTGGGAGAGCTGCGTGGGG + Intergenic
1094496611 12:30992927-30992949 CACTCTAGGACAGGTGGGAAGGG - Exonic
1095644633 12:44529101-44529123 GACTCTAGGGGAATTGGGTGTGG + Intronic
1095801524 12:46274061-46274083 CACTGTAGGAGAAATGGGAGTGG - Intergenic
1096159866 12:49367431-49367453 GGCTCTGAGAGAGCTGGGGGAGG + Intronic
1097282151 12:57851761-57851783 TTTTCTAGGAGAGCTGGGAATGG - Intergenic
1099162033 12:79253915-79253937 AACTCTATGAAAGCTGAGAGAGG + Intronic
1100189826 12:92178519-92178541 GAATCTAGGTGTGATGGGAGGGG + Intergenic
1101957383 12:109223089-109223111 GACTCTAGGAGAGGTGGGCATGG + Intronic
1102469343 12:113150730-113150752 GACTCTAAGTGAAGTGGGAGCGG - Intronic
1102517427 12:113459115-113459137 CAGTCTGGGAGAACTGGGAGAGG - Intergenic
1102753722 12:115319821-115319843 CACTCTGGAAGACCTGGGAGGGG + Intergenic
1103048828 12:117761402-117761424 GGCTCTGGGAGAGATGGGTGCGG + Exonic
1106550327 13:30765511-30765533 AACTGGAGGAGAGCTGGGGGAGG - Intergenic
1107421238 13:40248810-40248832 GAAACTAGGAGAGATGGGTGTGG + Intergenic
1108285942 13:48907934-48907956 GACTCTAGGTGGGGTGGGGGCGG + Intergenic
1108618460 13:52158917-52158939 GAGGCTAGGATAACTGGGAGAGG + Intronic
1110433690 13:75456112-75456134 GCCTATGTGAGAGCTGGGAGTGG - Intronic
1111920335 13:94403154-94403176 GAGACCAGGAGAGCAGGGAGTGG - Exonic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1113130468 13:107031133-107031155 GAGTTTAGGAGAGGTGGAAGGGG - Intergenic
1115730412 14:36262534-36262556 GTCTTTAGGGGAGTTGGGAGTGG + Intergenic
1115962866 14:38855216-38855238 GACTCTAGAGGGGATGGGAGTGG - Intergenic
1116831535 14:49724849-49724871 GACTCTAAATGAGCTGGGTGTGG + Intronic
1117030173 14:51660751-51660773 GACAGTAGGAGTGCTGGGGGAGG + Intronic
1120037550 14:79715324-79715346 CAGTCTAGGAGAGCTGGCTGAGG - Intronic
1121103012 14:91263050-91263072 GAGTCTTCGAGAGCTGGAAGTGG + Intergenic
1121199617 14:92106440-92106462 GCCTCTCGGAGGGCTGGGTGGGG - Intronic
1121862877 14:97336048-97336070 GACCCTGGAAGAGGTGGGAGGGG + Intergenic
1122939522 14:104975009-104975031 GTCTAAGGGAGAGCTGGGAGTGG + Intronic
1123207469 14:106727249-106727271 GACTTTAGGAGAGCTGAGGATGG - Intergenic
1123212491 14:106774243-106774265 GACTTTAGGAGAGCTGAGGATGG - Intergenic
1125506417 15:40270270-40270292 GCCTCTGGGAGGGCTGTGAGGGG - Intronic
1125786982 15:42327590-42327612 GACTCTGGGGGTGCTGGGAGAGG + Intronic
1126827796 15:52568964-52568986 GGCCCTGGGAGAGCTGGGACGGG - Intronic
1128898885 15:71401079-71401101 GACTTTGGGAGGGATGGGAGGGG - Intronic
1129235610 15:74222094-74222116 GACTCTTGGAGGGCTGGAAAGGG + Intergenic
1129257857 15:74344244-74344266 GTCTCCAGCAGAGCTGAGAGAGG + Intronic
1129848210 15:78777661-78777683 GACAGGAGGAGAGGTGGGAGGGG + Intronic
1130103493 15:80911962-80911984 AAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103498 15:80911981-80912003 GAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103509 15:80912029-80912051 GAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103517 15:80912067-80912089 AAGGCTGGGAGAGCTGGGAGAGG + Intronic
1130103522 15:80912086-80912108 GAGGCTGGGAGAGCTGGGAGAGG + Intronic
1132407433 15:101552314-101552336 AACTCCAGGAGAACAGGGAGTGG + Intergenic
1133172201 16:3988379-3988401 GACTCCAGGACAGGTGGGACGGG + Intronic
1133845136 16:9446523-9446545 GGGTCCAGGGGAGCTGGGAGCGG + Intergenic
1134052433 16:11146185-11146207 GACCCCTGGAGTGCTGGGAGTGG - Intronic
1136609472 16:31357324-31357346 GCCTCTGGGTGAGCTGGGTGGGG - Exonic
1137412303 16:48239270-48239292 AACTCTAGAAGGGCTGGGCGAGG + Intronic
1137817113 16:51408993-51409015 GACTTTAGAAGACCTGGGAATGG + Intergenic
1138082655 16:54105559-54105581 TAATCTAGGAGAGATGGCAGGGG - Intronic
1138555203 16:57766849-57766871 GACTGCAGGAGGGCTGGGGGTGG - Intronic
1140969514 16:79999404-79999426 GAGGCCAGGAAAGCTGGGAGTGG - Intergenic
1141158508 16:81613161-81613183 GCCTCTAGGAGAGCAGGTGGAGG - Intronic
1142027600 16:87822905-87822927 GACACTCAGAGAGCTTGGAGGGG + Intergenic
1142748355 17:1972359-1972381 GACTCTAGGAGCACTTAGAGAGG - Intronic
1142963437 17:3565680-3565702 GATTCTGCCAGAGCTGGGAGTGG + Exonic
1144946166 17:18970560-18970582 GATTTTAGCAGAGCTGAGAGTGG - Exonic
1145064183 17:19750889-19750911 GACTCAAGGAGAGTAGGTAGAGG - Intergenic
1145236939 17:21214725-21214747 GAGTCTAAGAGAACTGGGGGAGG - Intergenic
1147192776 17:38747477-38747499 GGCTCTAGGGAAGGTGGGAGCGG - Intronic
1147591774 17:41688676-41688698 GACTCTAGGAGAGCTGGGAGGGG - Intergenic
1148324869 17:46777353-46777375 GCCCCTTGGAGAGCTGGGTGAGG - Intronic
1148342847 17:46883875-46883897 GACTTGAGGAGGGATGGGAGTGG - Intronic
1148351356 17:46944061-46944083 GGCTCCTGGAGAGCTGGCAGAGG + Intronic
1149118665 17:53133210-53133232 GCTTCTAACAGAGCTGGGAGGGG - Intergenic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1149684772 17:58529003-58529025 GTCACTGGCAGAGCTGGGAGTGG - Intronic
1150575777 17:66429821-66429843 TACTATAGGAATGCTGGGAGTGG + Intronic
1150678301 17:67263732-67263754 GACTTTAGAAGAGCTGGGTGAGG - Intergenic
1151836642 17:76586352-76586374 GACGCCAGGACAGCTGGGAGGGG + Intronic
1151971522 17:77459964-77459986 GAGTCTGGGAGGGCTGGGTGAGG - Intronic
1152209176 17:78994049-78994071 GAATCCTGGAGAGCAGGGAGGGG - Intronic
1152646392 17:81470655-81470677 GATTCTAGGATATCTGGGATAGG - Intergenic
1153532315 18:6059728-6059750 GCTTCTAGCAGAGCTGTGAGTGG + Intronic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1153631344 18:7073107-7073129 CAGTGTGGGAGAGCTGGGAGAGG - Intronic
1154079050 18:11236137-11236159 GACTCCAGGAGGGATGGGAATGG - Intergenic
1155877110 18:31101645-31101667 CACTCAAGGAGAGGCGGGAGCGG - Intronic
1156518628 18:37702247-37702269 TACTCAAATAGAGCTGGGAGGGG + Intergenic
1156654648 18:39271025-39271047 AACTGTATGAGAGCTGGGAAGGG - Intergenic
1156681259 18:39591749-39591771 GACCCTGGGGGAGCTGGAAGGGG - Intergenic
1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG + Intronic
1157336175 18:46739163-46739185 GACTGAAAGACAGCTGGGAGGGG + Intronic
1157496550 18:48161270-48161292 TTCTCCAGGAGGGCTGGGAGTGG + Intronic
1158931203 18:62325936-62325958 GCCTCCAGGCGAGCTGGCAGGGG - Intronic
1159411111 18:68075568-68075590 GACCTTAGTAGAGCTGGGAGAGG + Intergenic
1160625550 18:80201894-80201916 GTCTCTGGGACAGCTAGGAGAGG - Intronic
1162246870 19:9408352-9408374 CTCTCTAGGAGAGCTGGTGGAGG - Intergenic
1162943213 19:14026645-14026667 GACTCTCGAAGTGCTGGGATTGG - Intergenic
1163625877 19:18389240-18389262 TTCTCTAGGAGACCTGGGAGGGG + Intergenic
1163665911 19:18604078-18604100 CACTCTAGAAGGGCTGAGAGGGG - Intronic
1166214192 19:41325140-41325162 GACCCCGGGAGAACTGGGAGGGG - Intronic
1166305991 19:41937289-41937311 GACTATAGGAGAGGGGGGAAGGG + Intergenic
1166315375 19:41986281-41986303 GACTCCAGGCGAGCAGGGACTGG - Intronic
1166624993 19:44343553-44343575 GATTCTGGGAGAGGTGGGAAAGG + Intronic
925262312 2:2539517-2539539 GTTCCCAGGAGAGCTGGGAGGGG - Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
929120034 2:38476823-38476845 GACTTGAGGAGGGCTGGGAGGGG + Intergenic
929444890 2:41993836-41993858 GACTCTAAGAAAGCTGGAGGCGG - Intergenic
930574334 2:53127569-53127591 GAATCTGGGGGAGCTGGGTGAGG - Intergenic
930889065 2:56361935-56361957 TAGTCTAAGAGAGCTGAGAGTGG + Intronic
930946620 2:57084149-57084171 GACTCCAGGAGAGGATGGAGAGG - Intergenic
932428115 2:71656499-71656521 GACTCTGGTAGAGATGAGAGTGG + Intronic
932845922 2:75135885-75135907 GAATATAGGGGAGGTGGGAGAGG - Intronic
933821828 2:86119644-86119666 GAGTCTAGGAAAGCTGGGCGCGG - Intronic
934853141 2:97713732-97713754 GGCTCTGGGAGACCTGGCAGAGG + Intronic
934854288 2:97719279-97719301 GGCTCTGGGAGAGGTGGGTGTGG + Intronic
935617718 2:105103059-105103081 GGCTGCAGGAGAGCTGGGGGCGG + Intergenic
936144638 2:109972096-109972118 GACTCTAGTAGGGCTGTGAGAGG + Intergenic
936181322 2:110270059-110270081 GACTCTAGTAGGGCTGTGAGAGG + Intergenic
936200049 2:110399373-110399395 GACTCTAGTAGGGCTGTGAGAGG - Intergenic
937691137 2:124756758-124756780 GCCTGTAGGAGGGTTGGGAGTGG + Intronic
938340915 2:130535908-130535930 GACTCAAGGAGAGCTGATGGTGG - Intergenic
938348915 2:130584801-130584823 GACTCAAGGAGAGCTGATGGTGG + Intergenic
940584373 2:155626493-155626515 GACCCCAGCAAAGCTGGGAGTGG + Intergenic
942743592 2:179206895-179206917 GACTCTATGGGAGCTGGGTGAGG + Intronic
944834282 2:203562808-203562830 GACTCTCGGAGCCCTGGGAGAGG + Intergenic
946200224 2:218067303-218067325 GGCTCCAGGAGAGCCAGGAGAGG + Intronic
946209006 2:218132244-218132266 GGGTCAAGGGGAGCTGGGAGAGG - Intronic
947586687 2:231360914-231360936 GACTCTCGGAGCTCTGGGAGTGG + Intronic
947754138 2:232549521-232549543 AACTCTATGAAAGCTGAGAGAGG - Exonic
948648532 2:239424519-239424541 GTCTCCAGGGGAGCTGGCAGTGG - Intergenic
948902502 2:240963626-240963648 GCGTCGAGGAGAGCCGGGAGGGG + Intronic
1168850547 20:973752-973774 CACTCTATGAGGCCTGGGAGGGG - Intronic
1169353543 20:4889449-4889471 CACCGTAGGAGAACTGGGAGAGG + Intronic
1172063959 20:32206809-32206831 GAGCCTGGGAGAGATGGGAGTGG + Intronic
1173181134 20:40807129-40807151 GACTCAGGGTGAGGTGGGAGAGG - Intergenic
1175723859 20:61303619-61303641 GACTTCAGGAGAGCTGGCACCGG - Intronic
1175990553 20:62786408-62786430 GACTCCAGGAGCCCTGGGGGTGG - Intergenic
1176103480 20:63375098-63375120 GTCTCTAGGGGTGCAGGGAGTGG - Intronic
1176304074 21:5114300-5114322 GACTGTGGAGGAGCTGGGAGTGG + Intergenic
1177903955 21:26952456-26952478 GAATTCAGGAGAGCTGGGAAAGG + Intronic
1178505906 21:33162835-33162857 GACAAGAGGAGGGCTGGGAGTGG - Intergenic
1178875993 21:36414247-36414269 GTCACGAGGAGAGCTGGGAAGGG + Intronic
1179018471 21:37616108-37616130 GGCTCGAGGAGACCTGGCAGAGG - Exonic
1179341283 21:40512489-40512511 GCCTGTAGGAGAAGTGGGAGAGG + Intronic
1180829633 22:18897222-18897244 GACACTAGGACTGCTAGGAGGGG - Intergenic
1181171538 22:21012808-21012830 GGCTCTGGGAGAGGTGGGGGTGG - Intronic
1182535957 22:31003067-31003089 GACTTTAGGTGAGATGTGAGTGG + Intergenic
1182713738 22:32338929-32338951 GCCCCCAGGAGAGCTGGGATTGG + Intergenic
1183663756 22:39235715-39235737 GACTTTAAGAGATCTGGGAGGGG - Intronic
1184101197 22:42342571-42342593 GACACTAGGAGAGGAGGCAGGGG + Intronic
1184401025 22:44274510-44274532 GCCCCCAGGAGAGCTGGGATTGG + Intronic
1185031823 22:48447899-48447921 GTCTGTAGAAGAGCTGGGAATGG - Intergenic
1203279724 22_KI270734v1_random:122494-122516 GACACTAGGACTGCTAGGAGGGG - Intergenic
950453614 3:13079503-13079525 GACTCAAGCAGGGCTGTGAGAGG + Intergenic
951120703 3:18924254-18924276 CACTCTAGGAGTGGTGAGAGAGG + Intergenic
951139724 3:19146968-19146990 GGCTCTAGGCTAGCTGGGCGGGG - Intergenic
954214862 3:49119012-49119034 GATCCTAGGAAAGGTGGGAGTGG - Exonic
955002873 3:54943306-54943328 GACACTAAGAGAGTTGGAAGTGG - Intronic
955494341 3:59515980-59516002 GATGCTGGGAGGGCTGGGAGTGG - Intergenic
960615526 3:119592460-119592482 GAATCCAGGAGACCTAGGAGGGG + Intergenic
966886908 3:184381866-184381888 GAAACTGGGAGAGCTGGGAGGGG + Intronic
968497570 4:927102-927124 GACTGCAGGTGAGCGGGGAGGGG - Intronic
968497593 4:927176-927198 GACTGCAGGTGAGCCGGGAGGGG - Intronic
968497627 4:927287-927309 GACTGCAGGTGAGCGGGGAGGGG - Intronic
968497639 4:927324-927346 GACTGCAGGTGAGCCGGGAGGGG - Intronic
968497649 4:927361-927383 GACTGCAGGTGAGCGGGGAGGGG - Intronic
968497661 4:927398-927420 GACTGCAGGTGAGCCGGGAGGGG - Intronic
968497671 4:927435-927457 GACTGCAGGTGAGCGGGGAGGGG - Intronic
968497683 4:927472-927494 GACTGCAGGTGAGCCGGGAGGGG - Intronic
968497703 4:927536-927558 GACTGCAGGTGAGCCGGGAGGGG - Intronic
968497714 4:927573-927595 GACTGCAGGTGAGCCGGGAGGGG - Intronic
968497725 4:927610-927632 GACTGCAGGTGAGCCGGGAGGGG - Intronic
968497735 4:927647-927669 GACTACAGGTGAGCGGGGAGGGG - Intronic
969254237 4:5991679-5991701 GCCCCTAGAATAGCTGGGAGAGG + Intergenic
969628590 4:8321906-8321928 TACTCAGGGAGAACTGGGAGGGG - Intergenic
974665188 4:64952362-64952384 GGCCCCAGGAGACCTGGGAGAGG + Intergenic
975134676 4:70863088-70863110 GACTCTATGACAGCTTGGGGTGG - Intergenic
975495126 4:75028737-75028759 TACTCTGAGAGAGCTGGGGGTGG - Intronic
979824394 4:125215632-125215654 GCCTTTAGGAGAGTTGGGATGGG - Intergenic
981899002 4:149839807-149839829 AATTCTATGAGAGCTGAGAGAGG - Intergenic
983981709 4:174005655-174005677 GAGCCTGGGAGAGCTGAGAGCGG - Intergenic
985557850 5:566140-566162 TACTCTAGCAGAGCTGGGCCAGG + Intergenic
988632604 5:32946922-32946944 GCCTCTAGGAAGGCTGGGAAAGG + Intergenic
990336181 5:54774964-54774986 GGCTCTGTGAGTGCTGGGAGAGG - Intergenic
991666436 5:69004460-69004482 GTCTATAGCAGAGCAGGGAGGGG - Intergenic
991944920 5:71890637-71890659 GAGTTGAGGAGAGCTGGGCGCGG + Intergenic
994858193 5:105153143-105153165 GATTCCAGCAGAGTTGGGAGAGG - Intergenic
995470731 5:112499558-112499580 TATTCAAGGAGAGCTGGGACTGG - Intergenic
997726449 5:136124262-136124284 GACGCTAGGAGAGGTTGGAAGGG + Intergenic
999248786 5:150169357-150169379 TACTCTCGGAGAGCAAGGAGGGG - Intronic
999344093 5:150799298-150799320 GCCTCAAGGAGAGCTCAGAGAGG + Intergenic
1000238672 5:159387995-159388017 GACTAGCTGAGAGCTGGGAGAGG - Intergenic
1001650479 5:173312315-173312337 GACTGTGGGAGAGGTGGGACGGG + Intergenic
1003224703 6:4192813-4192835 GACTCTGGCAGTGGTGGGAGTGG + Intergenic
1005836436 6:29713022-29713044 CACTCTAGGAGAAATAGGAGGGG + Intergenic
1006910358 6:37559424-37559446 GACCCTAGGAGAAAGGGGAGAGG - Intergenic
1007596597 6:43054573-43054595 GACTCAAGGAGAGAAGGGCGAGG + Intronic
1007627143 6:43253042-43253064 GAGTCTAGGAGAGATGGGACCGG + Intronic
1009846346 6:69140480-69140502 GAAGCTGGGAGAGCTGGGAGAGG + Intronic
1011095996 6:83663575-83663597 AATTCTAGGAGGGCTGAGAGAGG + Intronic
1011119104 6:83930934-83930956 AATTCTAGGAGGGCTGAGAGAGG - Intronic
1011215079 6:84997028-84997050 AACTCAAGGAGAGCTCAGAGTGG + Intergenic
1012284504 6:97372584-97372606 AATTCTATGAGAGCTGAGAGAGG + Intergenic
1017293771 6:152771183-152771205 TAGCCTAGGAGAGGTGGGAGTGG + Intergenic
1018040163 6:159914904-159914926 GACACTATGCCAGCTGGGAGTGG + Exonic
1022184073 7:27949843-27949865 GAGGCTAGCAGAGCTGTGAGAGG - Intronic
1025074155 7:55927940-55927962 GGTTCTAGAAGAGATGGGAGTGG + Intronic
1025840340 7:65141050-65141072 GACGCCAGTAGAGCTGGCAGCGG - Intergenic
1025878373 7:65509100-65509122 GACGCCAGTAGAGCTGGCAGCGG + Intergenic
1025882720 7:65554914-65554936 GACGCCAGTAGAGCTGGCAGCGG + Intergenic
1025890723 7:65647689-65647711 GACGCCAGTAGAGCTGGCAGCGG - Exonic
1029420631 7:100469983-100470005 GACTCTTGGGGTGGTGGGAGAGG + Intronic
1029708535 7:102287473-102287495 TACGCTGGGAGCGCTGGGAGGGG + Intronic
1031498772 7:122485505-122485527 GATTCTATGACAGCTGAGAGAGG + Intronic
1032318874 7:130866788-130866810 TCCTCTAGGGGACCTGGGAGAGG + Intergenic
1034784668 7:153914887-153914909 GAGACTGGGAGAGATGGGAGAGG - Intronic
1036604870 8:10295800-10295822 GAGTCCATGAGACCTGGGAGAGG - Intronic
1036652536 8:10654521-10654543 GGCTCTTGGAGAGGAGGGAGAGG - Intronic
1036740618 8:11358137-11358159 GGCTCTTGGCCAGCTGGGAGTGG + Intergenic
1037755008 8:21704929-21704951 GACTCCAGGAGGGGTGGGAGGGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038575840 8:28702295-28702317 GGCTCTAGGGGAGCTGGGCCTGG - Intronic
1040671086 8:49691475-49691497 GACTTTATGGGAGCTGGGAGAGG - Intergenic
1041604039 8:59759373-59759395 GTCTGGAGGTGAGCTGGGAGTGG + Intergenic
1042284456 8:67092731-67092753 GAAACTAGGTCAGCTGGGAGCGG - Intronic
1047222257 8:122928008-122928030 GACTTTACGAAAGCGGGGAGAGG - Intronic
1047564701 8:126031238-126031260 GCCCCTAGGAGAGCTGGGATGGG - Intergenic
1048868992 8:138781790-138781812 CACTGACGGAGAGCTGGGAGTGG - Intronic
1050917869 9:11160540-11160562 AATTCTAGGAAAGCTGAGAGAGG - Intergenic
1051181698 9:14418430-14418452 GACTCCTGGAGAGATGGGGGTGG - Intergenic
1051796611 9:20878936-20878958 CTCTCTATGAGAGCTGGGACAGG - Intronic
1054907552 9:70424038-70424060 GACTTTAAGAGAGCCTGGAGAGG - Intergenic
1056928789 9:90857721-90857743 TTCTCAAAGAGAGCTGGGAGAGG - Intronic
1058328874 9:103733978-103734000 CACTCTAGGAGAGCTCTGATAGG + Intergenic
1060389574 9:123267552-123267574 GGCTCCAGGAGACCTGCGAGGGG - Intronic
1060477185 9:123995652-123995674 GAGACAAGGAGAGCTGGGTGCGG - Intergenic
1060585520 9:124782943-124782965 GATTCCAGCAGAGCTGGGAAGGG + Intronic
1060735478 9:126064198-126064220 TGCTCTGGGAGAGCTGGGAGGGG + Intergenic
1061733941 9:132639319-132639341 GACTGGAGAAGAGCTGGGTGGGG - Intronic
1061750722 9:132775143-132775165 GACTCTTGGAGGTCAGGGAGAGG - Intronic
1061952890 9:133946060-133946082 GTCACTGGGAGAGCTGGCAGGGG + Intronic
1062431275 9:136527823-136527845 GACTCCAGGAGGGCTGCGGGGGG + Intronic
1062723677 9:138058936-138058958 GACTCGGGGAGAGCAGGAAGGGG + Intronic
1185768264 X:2744068-2744090 GGCTCTATGAAAGCTTGGAGAGG - Intergenic
1186481188 X:9896811-9896833 GACACTAGGAGATCTGGAAAAGG - Intronic
1187437103 X:19281930-19281952 AACTATAGGAGGGCAGGGAGTGG + Intergenic
1195786894 X:108534911-108534933 GATTCTAGAAGAGGTGAGAGAGG - Intronic
1195922542 X:109998089-109998111 GGCTCTTTGAGAGCTGGGAATGG - Intergenic
1196294198 X:113980147-113980169 GACTCCAGGGCAGCTGGCAGAGG - Intergenic
1197596492 X:128470303-128470325 CACTATAGGAAAGCTGGGGGAGG - Intergenic
1199063930 X:143391364-143391386 GAGACTACGAGAGGTGGGAGTGG - Intergenic
1199643597 X:149884567-149884589 GACTCCAGGTGAGCTGGGTCCGG - Exonic
1200059806 X:153479230-153479252 GAGGGAAGGAGAGCTGGGAGAGG - Intronic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200119042 X:153781849-153781871 AGCTCCAGGGGAGCTGGGAGTGG - Intronic