ID: 1147594678

View in Genome Browser
Species Human (GRCh38)
Location 17:41709197-41709219
Sequence AAAACCCCCTGTACACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147594672_1147594678 -4 Left 1147594672 17:41709178-41709200 CCCTGGCCTCACCAGTTCCAAAA No data
Right 1147594678 17:41709197-41709219 AAAACCCCCTGTACACCAGGAGG No data
1147594671_1147594678 8 Left 1147594671 17:41709166-41709188 CCATGATTCAAACCCTGGCCTCA No data
Right 1147594678 17:41709197-41709219 AAAACCCCCTGTACACCAGGAGG No data
1147594673_1147594678 -5 Left 1147594673 17:41709179-41709201 CCTGGCCTCACCAGTTCCAAAAC No data
Right 1147594678 17:41709197-41709219 AAAACCCCCTGTACACCAGGAGG No data
1147594668_1147594678 29 Left 1147594668 17:41709145-41709167 CCCAGCTAGTCGGTGTTAGAGCC No data
Right 1147594678 17:41709197-41709219 AAAACCCCCTGTACACCAGGAGG No data
1147594674_1147594678 -10 Left 1147594674 17:41709184-41709206 CCTCACCAGTTCCAAAACCCCCT No data
Right 1147594678 17:41709197-41709219 AAAACCCCCTGTACACCAGGAGG No data
1147594669_1147594678 28 Left 1147594669 17:41709146-41709168 CCAGCTAGTCGGTGTTAGAGCCA No data
Right 1147594678 17:41709197-41709219 AAAACCCCCTGTACACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147594678 Original CRISPR AAAACCCCCTGTACACCAGG AGG Intergenic
No off target data available for this crispr