ID: 1147599787

View in Genome Browser
Species Human (GRCh38)
Location 17:41738677-41738699
Sequence CAGGGTCAGGCCAGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147599787_1147599797 -6 Left 1147599787 17:41738677-41738699 CCCCCTCCCCTGGCCTGACCCTG No data
Right 1147599797 17:41738694-41738716 ACCCTGGGAAAAAAAACACCTGG No data
1147599787_1147599805 27 Left 1147599787 17:41738677-41738699 CCCCCTCCCCTGGCCTGACCCTG No data
Right 1147599805 17:41738727-41738749 GTAATAGAAAGAGCCCCTAAGGG No data
1147599787_1147599802 5 Left 1147599787 17:41738677-41738699 CCCCCTCCCCTGGCCTGACCCTG No data
Right 1147599802 17:41738705-41738727 AAAAACACCTGGAACAGGGTAGG No data
1147599787_1147599801 1 Left 1147599787 17:41738677-41738699 CCCCCTCCCCTGGCCTGACCCTG No data
Right 1147599801 17:41738701-41738723 GAAAAAAAACACCTGGAACAGGG No data
1147599787_1147599800 0 Left 1147599787 17:41738677-41738699 CCCCCTCCCCTGGCCTGACCCTG No data
Right 1147599800 17:41738700-41738722 GGAAAAAAAACACCTGGAACAGG No data
1147599787_1147599804 26 Left 1147599787 17:41738677-41738699 CCCCCTCCCCTGGCCTGACCCTG No data
Right 1147599804 17:41738726-41738748 GGTAATAGAAAGAGCCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147599787 Original CRISPR CAGGGTCAGGCCAGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr