ID: 1147600725

View in Genome Browser
Species Human (GRCh38)
Location 17:41743704-41743726
Sequence AAGCCAGGCAGAGGTAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147600720_1147600725 1 Left 1147600720 17:41743680-41743702 CCACAGTGGAGGGCAGAGTGGGC No data
Right 1147600725 17:41743704-41743726 AAGCCAGGCAGAGGTAGGGCAGG No data
1147600710_1147600725 17 Left 1147600710 17:41743664-41743686 CCTCACCCCCTTCTCTCCACAGT No data
Right 1147600725 17:41743704-41743726 AAGCCAGGCAGAGGTAGGGCAGG No data
1147600716_1147600725 10 Left 1147600716 17:41743671-41743693 CCCTTCTCTCCACAGTGGAGGGC No data
Right 1147600725 17:41743704-41743726 AAGCCAGGCAGAGGTAGGGCAGG No data
1147600717_1147600725 9 Left 1147600717 17:41743672-41743694 CCTTCTCTCCACAGTGGAGGGCA No data
Right 1147600725 17:41743704-41743726 AAGCCAGGCAGAGGTAGGGCAGG No data
1147600714_1147600725 11 Left 1147600714 17:41743670-41743692 CCCCTTCTCTCCACAGTGGAGGG No data
Right 1147600725 17:41743704-41743726 AAGCCAGGCAGAGGTAGGGCAGG No data
1147600712_1147600725 12 Left 1147600712 17:41743669-41743691 CCCCCTTCTCTCCACAGTGGAGG No data
Right 1147600725 17:41743704-41743726 AAGCCAGGCAGAGGTAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147600725 Original CRISPR AAGCCAGGCAGAGGTAGGGC AGG Intergenic